Q: Explain how many of the cells in an individual can be very different from one another in terms of…
A: All the cells of a given organism contain identical but different transcriptome and proteome.
Q: Explain how an organism uses gene expression to create a phenotype from a genotype.
A: The term 'Genotype' & 'Phenotype' are commonly used in the discipline of Genetics. Genetics is…
Q: At the molecular level, what causes incomplete penetrance? Answer in terms of protein function at a…
A: Incomplete penetrance occurs when in a heterozygote, a dominant allele does not express its trait in…
Q: Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is…
A: Nucleic acids are large molecules made up of nucleotides that help to build proteins and to express…
Q: COYOTE: Use your translated amino acid sequences to determine the phenotypes to include in your…
A: Phenotype are the external characteristics of any individual.
Q: List the different features of coding?
A: The set of different rules that are used through the living cells for translating information that…
Q: Give an example of genetic engineering and explain the genetic change involved in the process.
A: Genetic engineering are the process involved in change in genetic make up of organism via…
Q: Describe how genetic information can be altered.
A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…
Q: Describe the informational units or Genes.
A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…
Q: Explain why locating protein-encoding regions in a genomic sequence can be difficult.
A: Precise recognizable proof of protein-coding areas (exons) in DNA arrangements has been a difficult…
Q: Name the physical expression of genes in an individual.
A: A gene is a specific sequence of nucleotides in RNA or DNA that is located usually on a chromosome.…
Q: Explain how a mutation within a non-coding sequence may alter gene function.
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Explain the genome imprinting process ?
A: Genomic imprinting is a type of inheritance process that is different from Mendel's inheritance…
Q: Define the term genome?
A: Genome is a term frequently used in genetics and molecular biology. Gene is a functional unit of…
Q: Describe the process of gene expression, by which a gene affects thephenotype of an organism.
A: Central dogma of life involves gene expression, which indicates the flow of genetic information from…
Q: Define gene, genome, and exome.
A: DNA or RNA stores genetic information of a cell. A gene is a locus on a DNA molecule while genome is…
Q: Explain why a loss or an excess in genetic material leads to the expression of an abnormal
A: Introduction :- Mutations are changes in a gene's DNA that are abnormal. Bases are the basic…
Q: Create an analogy for the process of gene expression. In your analogy, be sure to explain the…
A: The genes are located on the chromosomes and it is the part of DNA sequence that ultimately produce…
Q: Define the regions made up of specific amino acid sequences ?
A: The amino acids are the protein components that are joined by peptide linkage (CO-NH) in the…
Q: Discuss an example of a human gene and the function of the particular protein molecule it codes for?
A: A gene is composed of sequence of DNAs, and each gene is transcribed to form an mRNA. Exons are…
Q: Describe the types of information that can be obtainedfrom an individual’s genome sequence.
A: Whole genome sequencing is the process of determining the complete DNA sequence of an organism's…
Q: Briefly explain differences in DNA and RNA genomes
A: A cell contains a nucleus inside which the genome is present. The genome represents all the genes…
Q: Explain why orthologs have sequences that are similar but not identical.
A: A homologous trait can be described as a homolog also spelled homologue. In terms of genetics, the…
Q: What is a gene and what do genes code for? What are alleles? Be specific
A: Genes are the basic units of heredity in living organisms. Genes make the structural and functional…
Q: For the P53, create a one page brief about the gene from genomics perspective
A: p53 is a gene that suppresses tumour and whose typical capacity is to confine or repress cell…
Q: Explain how protein-encoding regions are found when analyzing a DNA sequence.
A: Genes and intergenic gaps are found in the DNA of eukaryotes. Exons and introns are the two subunits…
Q: Which statement about the flow of genetic information is true? a. RNA encodes information that…
A: DNA or deoxyribonucleic acid is the genetic material of most of the organisms that is present within…
Q: Explain gene effect and give an example
A: The gene effects are the effect that leads to a mutation in a gene, these are inheritable changes…
Q: Describe the term gene.
A: The hereditary components are what make up the gene. Alleles, which are tiny genetic building blocks…
Q: a- What is genome assembly?
A: Sequence assembly is the process of matching & combining segments from a larger DNA sequence in…
Q: Describe how genetic information is duplicated, transferred, and expressed.
A: The cell possesses genetic material, which is in the form of DNA and RNA, which act in hereditary…
Q: Compare the mouse and human genomes?
A: Genome is the study of all genes present in the organism. Gene is a unit of heredity that is…
Q: Diagram a gene that is affected by CRE andCREB, showing which proteins and nucleic acids contact…
A: The specific transcription factor CREB binds to the CRE. When CREB is phosphorylated it also binds…
Q: Describe in detail the term gene .
A: The hereditary components are what make up the gene. Alleles, which are tiny genetic building blocks…
Q: Explain gene interaction and gene expression and give an example
A: A gene is defined as a segment of DNA which is responsible for the expression of a particular trait…
Q: Describe how a genome is mapped.
A: Genetic mapping includes the use of methods to recognize the locus of a gene and distance between…
Q: Please draw a diagram to show the genomic organization of a gene with three exons
A: mRNA is the transcript that is finally used as the template for protein synthesis.
Q: Give the information about DNA mutation types from SNP to large structural variation.
A: Hugo de Vries was the first one to coin the term “mutation.” It is studied under the domain of…
Q: Explain the Gene Expression: From DNA to Phenotype ?
A: Gene expression is the process through which information from a gene is utilized in the synthesis of…
Q: Explain the origin of orthologous proteins, paralogous proteins, and multidomain proteins.
A: Proteins can be defined as the macromolecules that consist of one or more long chains of amino acid…
Q: Genetic follow involves many molecules, what are they?
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: Describe about physical map of the genome from the genetic maps ?
A: Introduction Linkage can only occur in between the genes present adjacently on the same chromosome…
Q: For the p53 gene, create a summary with a proteomics focus. You can include protein domains, protein…
A: p53 gene: It is also known as TP53 or tumor protein . It is a gene that makes a protein that is…
Q: Define genetic information
A: Genetic material can be described in the form of DNA and RNA. DNA can be defined as the hereditary…
Q: Are all of your genes expressed in every cell in your body? Explain your answer and include an…
A: Ans. We have trillions of cells in our bodies. A variety of different organelles, such as…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
- Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesisDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
- DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate sequence could be transcribed instead of the template sequence. Draw the nontemplate sequence in 3’-5’ order (because remember you have to flip it for your brain to read it like RNA Polymerase would J). Then draw the mRNA sequence and translate it using Figure 14.6 (or any codon chart). Predict how well the protein synthesized from the nontemplate strand would function if at all.Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?
- Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’3’ direction.Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!