DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed. DNA: mRNA: polypeptide chain: b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to: a. the right DNA: mRNA: polypeptide chain: b. the left DNA: mRNA: polypeptide chain:
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’
From the given DNA sequence above, change one base in codon 8 to show same sense mutation.
Rewrite the resulting DNA sequence below and encircle the base that you changed.
DNA:
mRNA:
polypeptide chain:
b. Identify the type of base pair substitution that you applied in codon 8
Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:
a. the right
DNA:
mRNA:
polypeptide chain:
b. the left
DNA:
mRNA:
polypeptide chain:
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
