Q: During a heart attack, oxygenated blood flowing to the heart muscle is interrupted by blockage of a…
A: HEART ATTACK Heart attack is a condition in which the flow of oxygenated blood to the heart is…
Q: Which types of cell clusters synthesize insulin and glucagon?
A: Insulin and glucagon are the hormones secreted from the mixed gland. Their main function is to…
Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…
A: Introduction An electron transport chain is a collection of protein complexes and other molecules…
Q: What are initiatives that have to be done lower your household’s vulnerability to climate change
A: Environmental change drives have huge scope efforts to battle an Earth's global warming temperature…
Q: Which of the following are recommendations for dietary fat intake in athletes? Check all that apply.…
A: Option 1 is correct . Athletes should consume 20 to 35 percent of their calories from fat. Option 2…
Q: Please state the step-by-step procedure of SMEAR PREPARATION? (please explain it thoroughly in a…
A: The preparation of a smear is required for various lab procedures, including the Gram-stain. The…
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: How does we know that trees or plants are transpiring base on your experiment?
A: The physiological process by which water is lost in the form of vapour from the living tissues of…
Q: If a small part of the cell membrane surrounds a molecule so that it can enter a cell, then the…
A: Cell membrane, also called plasma membrane is the thin membrane that surrounds every living cell,…
Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…
A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…
Q: Purified proteins can have their mW determined by: Ethanol precipitation O SDS-PAGE O going to taco…
A: The application of scientific and technical principles to the processing of the material by…
Q: Ascaris lumbricoides, I.s. Illustrate the stages of mitosis, as seen under HPO. Label the stages…
A: Answer :: Cell division:- Cell division happens when a parent cell divides into two or more…
Q: how the genes are related to intellectual disability in details
A: Answer :- As we know that incorporates Fragile X disorder (FXS), the most well-known acquired type…
Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…
A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…
Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…
A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…
Q: What is the pH of blood? The pH Scale Ammonia Stomach Acid Vinegar Coffee Water Baking Soda Solution…
A: pH is the measure of how acidic or basic a liquid is. Range of pH scale is 0-14. <7 being the…
Q: Which of the following are true for the c-myc gene? Select all that apply
A: Myc is a group of regulator genes that code for transcription factors. c-myc is one of the genes in…
Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…
A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…
Q: Discuss the physical structure of either a forest or a lake, and explain how the physical structure…
A: Lake is an open body of shallow depression containing water usually freshwater. Different types of…
Q: List three characteristics that distinguish Homo sapiens from premodern Homo Homo sapiens have a…
A: Scientific data gathered on human evolution suggests that the physical as well as behavioral…
Q: . Why is the relationship P=p2 used for homozygous loci?
A: Introduction :- Homozygous for a given locus refers to diploid and polyploid cells that have the…
Q: Cancer is a disease that results in uncontrolled cell division. Cancer cells have lost the ability…
A: Mutations are the changes in the DNA sequence. The mutations can be neutral, beneficial or harmful.…
Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…
A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: Determine whether each of the following statements are true or talse as argued by Legović and Geček…
A: 1) yes its a true statement , the biotic potential is defined as the maximum number of the offspring…
Q: How does exercise influence postprandial lipemia and hyperglycemia? What is a mitochondrial…
A: Exercise also aids in the reduction and alleviation of pre-existing health problems. Exercising…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: When the body fails to carry out the normal metabolic functions due to rare genetic conditions it…
Q: Describe the process of DNA replication of the leading strand?
A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…
Q: Solve in digital format to be able to pass it to word Look at the following scheme: why we say that…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…
A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…
Q: Please draw a diagram that shows the interactions among biotic components of the savanna ecosystem.
A: A savanna ecosystem consists of mixed woodland and a grassland ecosystem. It is distinguished by…
Q: Explain briefly the mechanism of Magnetic Resonance Imaging (MRI) and how is Ampere's Law applied in…
A:
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Answer :- Option ( D) is correct. - The organs arising from quail somites develop in the reverse…
Q: what is the difference between DNA microarray and Fluorescence in situ technique? or is the…
A: Difference between FISH and Microarray Technique Fluorescence In Situ Hybridization It is possible…
Q: why a mutant Ras is an oncogene causing many human cancers
A: Ras proteins are proto-oncogenes that are frequently mutated in human cancers.
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: Outline the structure and function of the brain, spinal cord, peripheral nerves and the autonomic…
A: Function of Brain:- Central coordinating center of the body. Place of association areas and all…
Q: please can you help me Discuss how the major endocrine glands and the hormones they produce…
A: Endocrine glands are the ductless glands that secrete hormones into the bloodstream.
Q: All about RNA editing A. changing one or more nucleotides in the RNA transcript by deamination B.…
A: In this question when we look at options then we don't need to check B and C options as it's in…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…
A: Mitochondria is also known as the powerhouse of the cell.
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…
Q: Across plant thr Shawnee believe caused milk sickness
A: Introduction Tremetone is a chemical compound found in tremetol, a toxin combination derived from…
Q: Septic shock is life - threatening condition caused by an overwhelming
A: Septic shock- it is a condition sometimes occurs in severe sepsis, in which the blood pressure…
Q: What is the role of lactic acid? It is converted to pyruvic acid through glycolysis. It is a…
A: Introduction Lactic acid is an integral part of the human body, it is is a chemical byproduct of…
Q: Explain in detail how phosphorylation of retinoblastoma (rb) protein leads to transition of the cell…
A: The RB1 (retinoblastoma 1) gene codes protein called pRb. It is a tumor suppressor gene (genes whose…
Q: Bacteria do not have mitochondria; however, they include an electron transport chain since there are…
A: Microbes may enter the body in a variety of ways and cause infection everywhere, but antigen and…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…
Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…
A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
How can Ghana increase production of Papain
Step by step
Solved in 2 steps
- Name two (2) main producers of Ginger and two (2) main importers of Gingerwhat are the nutritional requirement of cowpeas/blackeye peas cropsPatchouli essential oil comes from the patchouli plants of tropical East and Southeast Asia; it is: Choose one answer. a. steam distilled from the leaves b. extracted via enfleurage c. steam distilled from the flowers d. macerated from the leaves