Give economic and ecological significance of Corn (Zea)

Q: Calculate for the water activity of the soy sauce in 80.3% ERH. Suppose the soy sauce is subjected…

A: Water activity is measure of energy status of water in a system.If more energy then microbial…

Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…

A: The electron transport chain is located in the mitochondria in eukaryotes and in the plasma membrane…

Q: You are studying a cell line that expresses both GPCR-A and G <-B, each receptc binds the same…

A: GPCR A increases cAMP and GPCR B decreases it. Hence any mutation affecting the GPCR B will be…

Q: What cell receptor does adrenaline reach

A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…

Q: what us bZIP and bHLH protein domains? how are they similar? how are they different?

A: Enzymes can bind to DNA to regulate different processes of DNA by certain motifs .

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…

Q: give an example of creation myths in the philippines stories

A: Introduction Philippine mythology is a collection of stories and epics derived from and incorporated…

Q: In your words explain passive transport by osmosis using isotonic, hypertonic, and hypotonic in both…

A: Osmosis It is passive transport. In this type of transport, the water moves across the semipermeable…

Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…

A: The regulation of concentration of body fluids is called as osmoregulation. • The plants absorb…

Q: If corn has 10 chromosomes, how many chromosomes will be present after meiosis I. a. 20 b.10 c. 5 d.…

A: ANSWER) (c) 5 In the meiosis 1 the number of chromosomes is reduced by half. So 5 chromosomes will…

Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…

A: Nucleus is main controller of the cell which possess genetic information . It also contain long…

Q: Draw the keto or enol tautomer for each of the following compounds when they were treated with…

A: 1. Propanol on being treated with traces of acids or bases, its structure is converted to Propanone.…

Q: What plant process involved in your experiment aside from transpiration?

A: Plants are vital living forms that belong to the Plantae taxonomic kingdom and are further classed…

Q: Why is reprouctive isolation insuffecient to define a species?

A: Reproductive isolation refers stopagge in the ability to reproduce successfully with sexual…

Q: estrogen receptor (ER)-positive or -negative.

A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…

Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…

A: BLAST stands for Basic Local Alignment Search Tool (BLAST) This is helpful in finding location of…

Q: The ff. mothers, (A) through (E) with given phenotypes, each produced one child whose phenotype is…

A: This question can be done by splitting each trait and crossing the concerned trait of mother and…

Q: 4. The diagram illustrates the activity of vesicles during a cellular process. Which statement best…

A: Golgi body use to release the vesicles which contain the material of the cell. The main function of…

Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…

A:

Q: Choose 1 biotechnology product in the field of agriculture. Provide a 1-3 minute monologue about…

A: Biotechnology is a branch of technology that is based on biology.  The use of living systems and…

Q: Determine whether each of the following statements are true or talse as argued by Legović and Geček…

A: 1) yes its a true statement , the biotic potential is defined as the maximum number of the offspring…

Q: Think of reasons why it is important to maintain the number and structure of chromosomes

A: Genes are passed from parent to child making each of us unique.Chromosomes are thread-like…

Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: How can you tell someone’s social class? What indicators can be misleading?

A: A group of members present in a society divided on the basis of their social and economical status…

Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?

A: Answer--

Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…

A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…

Q: 1. In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2g². In another…

A: Introduction :- Phenotypic variance is a term that refers to the combination of genotype and…

Q: ic Variation and Evolution Mastery Quiz ay 2 at 2:40pm Instructions Question 1 1 pts In Mendel's…

A: In monohybrid cross of Mendel's experiments : Dominant = TT Heterozygote = Tt  Recessive = tt

Q: You are studying a cell line that expresses both GPCR-A and GPCR-B, each receptor binds the same…

A: The G-protein couples receptor signalling is mediated by a seven pass transmembrane receptor located…

Q: Argosomes Cytonemes

A: Cell biology is the study of cell structure and function, and it revolves around the concept that…

Q: Helping tags: Biology, microbiology, Vibrio spp. It's a common practice in some countries to eat…

A: Oyster refers to a group of salt-water bivalve molluscs that dwell in marine or brackish…

Q: Anther Filament- Banner -Wing Peta Keel petal

A: A flower contains two types of reproductive parts : Female: Stigma, Style, Ovary (Pistil) Male:…

Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…

A: Satiety is feeling of fullness. Thus insulin causes satiety meaning that it induces the increasing…

Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…

A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…

Q: Genetic problems: Use the diagram below to figure out how each monosomy or trisomy can a) Normal X…

A: 1) Trisomies and monosomies are two types of chromosomal abnormalities. Specifically, a trisomy is…

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: Mimicry and warning coloration are general forms of defensive nature exhibited by organisms.…

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…

A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…

Q: 2) Now you would like to raise antibodies to this protein of YFG. How could you use the pure protein…

A: Antibodies generate by the immune system in body against the antigen which is foreign particle…

Q: VSV-GFP- SARS-CoV VSV-GFP- SARS-CoV-2 U Plaque Day 3 (duplicate) 1.51 1.0- 0.5- 0.0 VSV-GFP-…

A: In virology, spike protein or peplomer protein is the type of protein complex with the large…

Q: A dominant allele that arises from recurrent mutation is mildly deleterious. The fitness of…

A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of errors in…

Q: Do the following mathematical calculations to figure out the work each hand did: Work = 1…

A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…

Q: MULTIPLE CHOICE. A B C D or Duhh 1) Molecules assisted by a transport protein may cross a selective…

A: Introduction :- Active transport is the movement of molecules across a cell membrane against a…

Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?

A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .

Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…

A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…

Q: A heterozygous plant of AaBb genotype was testcrossed and gave the following results.   Phenotypes…

A: A trait is a characteristic feature that is unique to particular individual . A dihybrid cross is a…

Q: You would like to design a method to treat the most common mutation that causes sickle cell anemia…

A: Precise genome editing is a potential technique for discovering causative genetic variations and…

Q: What is biomass

A: Biomass is defined as the total quantity of plants in a particular area.

Q: 5

A: Answer cat ovary with labelling

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A: