How does the small intestine have such a large surface area? Why is a large surface area important? Explain.

Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...

A: Being a doctor and taking this question as in general category. One should do the followings things ...

Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...

A: Egg white It refers to the clear liquid present inside the egg. It is formed from the layers of secr...

Q: Which of the following characteristics of a water-insoluble substance is most important in governing...

A: Cell membrane It is also referred as the plasma membrane. It  separates the cell's interior environm...

Q: What is the importance of Gametogenesis and Spermatogenesis in Meiosis?

A: Gametogenesis Formation of gametes. Gametes develop in the gonads(sex cells). In male, it is sperma...

Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne...

A: Permutation infers the maximum number of possible arrangements by given things/ variables that can b...

Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...

A: Introduction: Hyperkalemia is a condition of high potassium levels in blood.

Q: What is the bearing of the following factors in establishing a taxonomic character: (a) numbers, (b)...

A: In biology, taxonomy is the scientific observation of naming, defining, and classifying corporations...

Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?

A:      INTRODUCTION          Evolution is a main thing happened by a natural process that mainly occur...

Q: Match each term with the best description. ___ DNA replication                a. basis of variation ...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: The lumbar region is ________.a. inferior to the gluteal regionb. inferior to the umbilical regionc....

A: Vertebrae of a human spine is divided into cervical, thoracic, lumbar, sacral and coccygeal. Out of ...

Q: A marathon runner was disoriented and delirious post-race, and was found to have a serum [Na ] 128 m...

A: The correct option is C.

Q: What is the process of gene expression? and what role does RNA play in gene expression?

A: Gene expression involves two important processes that are transcription and translation. Both proces...

Q: What are the conditions that might cause a cell to halt the cell cycle

A: Introduction: A cell cycle is a set of events that occur in a cell as it divides and grows. A cell s...

Q: Give the functions of the following bacterial structures. Granules Pili Flagella Endospores Capsule

A: Bacteria is a prokaryotic cell which has many organelles to facilitate different functions.

Q: Simian Virus 40 is carcinogenic in primates.  1). which molecule of the virus 2). what particular ...

A: Viruses come under the category of microorganisms (tiny creatures) that can be found in the environm...

Q: Determine which of the following passages are arguments. For those that are, identify the conclusio...

A: Note- As we are allowed to answer only one question at a time. I will provide answer for only first ...

Q: The normal level of calcium in blood ranges from 8.5 to 10.2 mg/dL. It must be tightly controlled. M...

A: Hormones are biological compounds secreted by neurosecretory or endocrine glands that help to mainta...

Q: Match the terms with the most suitable description. ___ operon                     a. makes a man ou...

A: The options are matched with the suitable description and they are given below

Q: An unknown microbe is found to be able to photosynthesize, but is also able to fix pyruvate for carb...

A: An autotroph is an organism that can produce its own food using light, water, CO2 and other chemical...

Q: What is the value of mitochondrial fission and fusion?

A: Mitochondria is a double membrane-bound organelle.

Q: In a compound microscope consisting of a 5 mm objective lens and an eyepiece (2.5 cm) eyepiece, an o...

A:

Q: Calculate the viral titer of an experiment performed yielding a pfu of 279 from plating 1.0 ml of th...

A: To determine viral infectivity, common practice is to perform a viral titration to infect the host c...

Q: 13) True or false: fragmentation spectra obtained from a mass spectrometer can help identify molecul...

A: Mass spectrometry is a technique for determining the mass-to-charge ratio (m/z) of one or more molec...

Q: C. Draw and place arrows that correspond to the structures of a liver cell or һеpatocyte. Cell Membr...

A: Liver: The liver monitors blood from the digestive organs, processes nutrients, eliminates toxins, p...

Q: What is the importance of ecosystem services and what are the benefits does the biodiversity gets in...

A: Ecosystem services and their sustainable use is very essential. 

Q: Chromosome type not exhibited by humans. * 2. Chromosome type with noticeably short p-arm. * 3. When...

A: The study of the molecular basis of biological activity in and between cells, including molecular pr...

Q: Disorder of Sex Determination Now that you have reviewed typical sexual determination in humans, it ...

A: Swyer syndrome  It is an uncommon disorder that causes the sex glands (testicles or ovaries) to fai...

Q: Describe the impact that the need for lumber and agricultural land has had on the environment. Expla...

A: Impact of Lumber on the environment:- Increases the harmful effect of winds and rain  The local val...

Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...

A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...

Q: Which of the following is an example of allosteric regulation? A. the binding of CAMP-CAP to DNA B. ...

A: Allosteric regulation is a form of regulation where enzymes or molecules are regulated by binding to...

Q: A trihybrid individual with the genotype QqRrTt is testcrossed with a qqrrtt individual. The resulti...

A: A trihybrid cross is a cross between two individuals of the same species for the purpose of studying...

Q: The ADP/ATP carrier, which exchanges cytoplasmic ADP and mitochondrial ATP, can also function as a p...

A: Answer :: a) Proton pumping rate, electron transport rate, rate of oxygen uptake : remains the same ...

Q: If you notice on your agar plate that there are more than one color of colonies-- What does this mea...

A: A bacterial colony is what you Called a set of bacteria derived from the same mother cell. which mea...

Q: What are the 3 phase of the routine stool examination?  2. What would be the pre-analytical phase i...

A: Human feces is known as stool.It is the waste residue of indigestible materials of an animal's diges...

Q: Can you help me to explain these dna model

A: DNA( Deoxyribonucleic acid) is a molecule that carries all the information from one generation to th...

Q: Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biom...

A: Introduction: The given diagram depicts the production of peptide bonds, which are responsible for t...

Q: Identify

A: The organism which causes the above shown infection is Candida albicans.  

Q: Based on the figures given, 1. What range of time and temperature combinations poses the highest ri...

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...

Q: Oxygen is required for the mitochondria to produce ATP. True

A:

Q: If you are provided with a CHO cell line expressing an adrenergic receptor, how could you experiment...

A: Introduction :- Chinese hamster ovary (CHO) cells are epithelial cell lines derived from the ovaries...

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with ...

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple...

Q: Briefly answer the question below: What is the disadvantage of having a really thick smear when stai...

A: Smear:- It is used to fix the bacteria onto the slide and to prevent the sample from being lost duri...

Q: 4. If the malaria parasite is eradicated from an area where it used to be prevalent, what expect to ...

A: Introduction :- Malaria a disease which is caused by the plasmodium protozoan , for example :- plasm...

Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from...

A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample i...

Q: What is DNA Replication? when can it happen? what are the steps in the process of DNA Replication? a...

A: Replication is the process by which DNA duplicate it's own strands . Replication of DNA is is divisi...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characte...

A: Eukaryotic organisms have well-developed nuclei surrounded by nuclear membrane while prokaryotes do ...

Q: Question 314 Brain-heart infusion broth (BHIB) would best be described as: a) a selective medium O b...

A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid solution used to p...

Q: A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, howev...

A: Plasma membrane is a bilayer structure composed of phospholipids that has different proteins embedde...

Q: What will happen to you if your brain is damange?

A: Introduction Brain:- The brain is one of the largest and most complex organs in the human body that ...