can you help me Activity No. 5.2 DNA Base PairingNameSectionThere are base pairing rules for writing complimentary DNA strands for a given strand.A pairs with TC pairs with GIn RNA,A pairs with U, instead of T.Write the complimentary DNA strand for each given strand of DNA.1. CGTAAGCGСТААТТА2. TCTTAAATGATCGATC3. AATGAATAGCTAGCTT4. GGCATTCGCGATCATG5. CGTTAGCATGCTTCAT6. ACTAACGGTAGCTAGCNow write the mRNA strand for the given DNA strand.7. ATGTCGCTGATACTGT8. GAAGCGATCAGTTACG9. AATGAATAGCTAGCTT10. GGCATTCGCGATCATG11. CGTTAGCATGCTTCAT12. ACTAACGGTAGCTAGCWrite the tRNA sequence for the given strand of mRNA13. AGGUCAUGCAUGGGCAUGCAU14.AGAGAUUCAGCUAGCACGAUA15.GUCAUCGAUCGAUCGGAUGCC16.UUUCAGUCAGCUAGCGAUCGUNow you will translate the amino acid sequence for the given tRNA strand. Remember thatcodons are 3 base pairs long.17. AUG CAC UGU CCU UUC GCU GÁC18. GAG AUC UGG UUG GAA UCG19. AGC GUA UUA ACG UAU CAU20. AGU CGA UCG AUG CGG AUG AUA21. GUC GUC GAU AGC UAU CAU GCATranscribe the following DNA strand. Then translate the TRNA strand you w22. TGAGTCGACTGGCTGACCGTAGAC23. CTTGGCTTATGGTGGTTCGCTCGC

According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with T C pairs with G In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA. 1. CGTAAGCGCTAATTA 2. ТСTTAAАTGATCGATC 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. АСТААСGGTAGСТАGC Now write the mRNA strand for the given DNA strand. 7. ATGTCGCTGATACTGT 8. GAAGCGATCAGTTACG 9. AATGAATAGCTAGCTT 10. GGCATTCGCGATCATG 11. CGTTAGCATGCTTCAT 12. АСТААСGGTAGCTAGC Write the tRNA sequence for the given strand of MRNA 13. AGGUCAUGCAUGGGCAUGCAU 14.AGAGAUUCAGCUAGCACGAUA 15.GUCAUCGAUCGAUCGGAUGCC 16.UUUCAGUCAGCUAGCGAUCGU Now you will translate the amino acid sequence for the given RNA strand. Remember codons are 3 base pairs long. 17. AUG CAC UGU CCU UUC GCU GAC

There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with T C pairs with G In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA. 1. CGTAAGCGCTAATTA 2. ТСTTAAАTGATCGATC 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. АСТААСGGTAGСТАGC Now write the mRNA strand for the given DNA strand. 7. ATGTCGCTGATACTGT 8. GAAGCGATCAGTTACG 9. AATGAATAGCTAGCTT 10. GGCATTCGCGATCATG 11. CGTTAGCATGCTTCAT 12. АСТААСGGTAGCTAGC Write the tRNA sequence for the given strand of MRNA 13. AGGUCAUGCAUGGGCAUGCAU 14.AGAGAUUCAGCUAGCACGAUA 15.GUCAUCGAUCGAUCGGAUGCC 16.UUUCAGUCAGCUAGCGAUCGU Now you will translate the amino acid sequence for the given RNA strand. Remember codons are 3 base pairs long. 17. AUG CAC UGU CCU UUC GCU GAC

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Question: DNA molecules are compressed by integrating with non-nucleic acids. What property of these DNA binding molecules make them most attracted to DNA-A) High PolarityB) Nonpolar BackbonesC) Large SizesD) Positive Charge Answer?
Problem 4: You are planning an experiment to use zinc finger nucleases to generate a double-stranded DNA break in a targeted sequence of DNA Name the protein domain in a zinc finger nuclease that is responsible for generating the DNA break Fok1 Name two other genome-engineering proteins that could be used for generating the double-stranded DNA break What are the advantages and disadvantages of each strategy?
Question- If chemically competent E coli cells are disrupted by CaCL2 and a heat shock to take up DNA, how would electrocompetent E coli cells take up DNA?
Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed in DNA sequencing and how and where would the reaction begin? Also, what raw materials are needed?
BIOC 385 Deciphering the Genetic Code Q11.3: Describe the THREE experimental approaches used to decipher the Genetic Code
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Question:- What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9 nm and and is 3019228 links long? If the two strands of the double-stranded DNA are separated, each chain now has a radius of 871 nm. What is the link length for single-stranded DNA?
22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
Question:- Why do we need endonucleases to cut DNA if we are 60-70% water that was shown to hydrolyze phosphate bonds?
MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.
Question:- How many different types of alterations in chromosomal numbers are there? -How can I use the F plasmid to introduce the transfer of the URA+ gene from a wild type strain into the ura- mutant strain you isolated in Q5. -After obtaining the ura- mutant, I want to transform this ura- mutant back to wild type with a DNA sample prepared from the wild type cell. How can I achieve this transformation experimentally?
True or False? 454 platform sequencing involves attaching single -stranded DNA fragments to beads, which are embedded within a 96-well plate . The plate is exposed to separate washes of single nucleotides , which are used by DNA polymerase to synthesize complementary DNA. Each time a nucleotide is added, a pyrophosphate is released.