How the process of chromatin condensation is performed? Further chromatin condensationNucleusInterphasechromosomeTopologicaldomains5-24 nmChromosomechromatinfiberterritoryHistone H1"Beads on a string"DNANucleosomeMajor Types of DNA SequenceSingle-copy genesGene familiesExons and intronsIntergenic DNAMobile DNA elementsTandemly repeated genesSimple-sequence DNALodish et al., Molecular Cell Biology, 9e, © 2021 W. H. Freeman and Company

As we understand, the cell DNA is never exposed and unaccompanied by different proteins. Maybe, it…

Answered: How the process of chromatin…

Science

Biology

How the process of chromatin condensation is performed?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 13P

See similar textbooks

Related questions

Q: Why do chromosomes have moredifferent types of nonhistone than histone proteins?

A: Both histones and non-histones are proteins that contribute to the DNA structure. These are the main…

Q: Compare heterochromatin and euchromatin. What are the differences between them?

A: Deoxyribonucleic acid (DNA) in the eukaryotic cell nucleus present in a highly compacted fashion.…

Q: Why Heterochromatin spreads linearly?

A: Heterochromatin refers to the part of the chromosomal regions that appear dark due to the…

Q: explain Scope of heterochromatin effects?

A: Chromatin means DNA +proteins (histones) or histones combine with DNA known as chromatin. Both the…

Q: What is the replication problem at chromosome ends?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: Describe chromatin when the CpG islands are methylated?

A: The eukaryotic chromosome is made of half DNA and half proteins. Out of total proteins, one half is…

Q: What are heterochromatin and euchromatin?

A: Every protein and genetic trait in the human body is encoded by these nucleotides, which are…

Q: What is chromatin immunoprecipitation?

A: Chromatin immunoprecipitation is an experimental technique used to investigate protein DNA…

Q: what is telomerase

A: All cellular systems are controlled by proteins. Proteins are synthesized by the cell by a process…

Q: How epigenetic modifications alter chromatin structure ?

A: Epigenetics is often connected with alteration to chromatin structure. It is studied under the…

Q: During S phase, how are histonesand their modifying enzymescontrolled to replicate…

A: Cells reproduce by a cycle of growing and dividing called a cell cycle. The cell cycle is the…

Q: how can the chromosome packaging inside the nucleolus *

A: Chromosomal DNA is packaged inside microscopic nuclei with the help of histones. These are…

Q: Explain the term heterochromatin ?

A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide chain. Both the strands coil around…

Q: What can happen to chromosomes in cancer cells?

A: Cancer cells vary from normal cells in a range of ways. Normal cells become cancerous after a…

Q: What two properties, one structural and one functional,distinguish heterochromatin from euchromatin?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: How do chromatin modifications regulate transcription?

A: Chromatin is a complex of protein and DNA, present in eukaryotic cells. Its main function is to pack…

Q: Explain the Conservation of Chromatin Structure.

A: Chromatin Structure: It is composed of DNA and histones that are packaged into thin, stringy fibers.…

Q: How are the processes of DNA replication and transcriptionsimilar? How are they different?

A: DNA replication of transcription are the processes that are involved in the central dogma. DNA…

Q: Define the Chromatin Remodeling ?

A: Genes are the hereditary unit of an organism. The genes have DNA (deoxyribonucleic acid) which code…

Q: Why Interphase Polytene Chromosomes Arise by DNA Amplification?

A: The gene is the unit of heredity for all living entities. This resides in the form of chromosomes…

Q: Explain the chromatin remodeling complexes ?

A: In eukaryotes, the DNA is firmly twisted and tightly coiled into a complex called Chromatin. This…

Q: Distinguish between heterochromatin and euchromatin.

A: Two types of chromatin (euchromatin and heterochromatin) are distinguishable during the interphase.…

Q: What is the unit of a genetic map?

A: Genetic map: Gene mapping as the name suggests that it is the map of genes that are present inside…

Q: Define the heterochromatin ?

A: The chromosomes in the cell nuclei can be seen in different sizes and shapes through out the cell…

Q: What are interchromatin compartments ?

A: A cell is comprised of several components including nucleus, cell membrane, and cell cytoplasm.…

Q: Differentiate between the Euchromatin and Heterochromatin

A: Chromatin is a complex of DNA and protein found in eukaryotic cells. Its primary function is…

Q: Explain the channels of the interchromatin compartments ?

A: The nucleus is the most important organelle present in the eukaryotic cells and is made up of a…

Q: What is the function of euchromatin?

A: The chromatin is the complex formed by the condensation of DNA and histone proteins. Chromatin…

Q: What is the purpose of heterochromatin and does heterochromatin transcribed?

A: Heterochromatin is a condensed or tightly packed form of DNA that comes in multiple varieties. These…

Q: Is a centromere a protein and tell What happens if a centromere does not break?

A: Centromere is a central chromosome structure that attaches sister chromatids during cell division.…

Q: how can the chromosome packaging inside the nucleolus

A: Histones generally define that they are been helped the chromosomal DNA to be packed inside tiny…

Q: What is the difference between euchromatin and heterochromatin?

A: Chromatin is a complex of deoxyribonucleic acid (DNA) and protein present in eukaryotic cells. The…

Q: Describe the organization of the interphase nucleus. Include inyour presentation a description of…

A: DNA is a molecule found in the nucleus by Friedrich Meischer in the late 1860s, but its function was…

Q: Explain, How does histone acetylation alter chromatin structure?

A: DNA is the genetic material present in the cell.

Q: How eukaryotic cells modify chromatin ?

A: Eukaryotic cells modify chromatin through the process called chromatin remodeling. In the process,…

Q: What is chromatin condensation?

A: The sequence of events by which a cell duplicates its genome, synthesis the other constituents of…

Q: How does KU proteins promote DNA repair during mitosis? Explain.

A: DNA repair It involves different processes through which a cell determines and rectifies the damage…

Q: What are some of the processes that affect gene regulation by altering chromatin structure?

A: The mechanism of encoding of proteins by a gene which regulates cellular functions is known as gene…

Q: Differentiate between Centromere and Telomere.

A: Chromosome is the rod shaped, dark stained bodies which are most prominently seen in the metaphase…

Q: Why is chromatin packaging important?

A: Chromatin is a material that makes up the chromosomes consisting of DNA and proteins. DNA is the…

Q: Define about chromatin assembly factors (CAFs) ?

A: A chromosome's chromatin is a DNA and protein-based material. The genetic instructions for a cell…

Q: how does histone acetlation affect chromatin structure and gene expression

A: Genes are a type of hereditary unit that directs protein synthesis in living organisms. Through…

Q: Why Most Genes in HeterochromatinRegions Are Silenced?

A: Chromatin is the DNA packed with its packaging proteins.

Concept explainers

Sleep Physiology

Sleep is a condition of reduced muscle movement in the body. Awareness about the surroundings is reduced at the time of sleep. The body stays mildly responsive or non-responsive to external stimuli. The sleep-wake cycle is controlled by the circadian rhythm that produces a resting phase for the body.

Question

How the process of chromatin condensation is performed?

Further chromatin condensation
Nucleus
Interphase
chromosome
Topological
domains
5-24 nm
Chromosome
chromatin
fiber
territory
Histone H1
"Beads on a string"
DNA
Nucleosome
Major Types of DNA Sequence
Single-copy genes
Gene families
Exons and introns
Intergenic DNA
Mobile DNA elements
Tandemly repeated genes
Simple-sequence DNA
Lodish et al., Molecular Cell Biology, 9e, © 2021 W. H. Freeman and Company

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

What are chromatins?

VIEW

How does chromatin condensation occurs?

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
6) There is clear evidence that chromatin state is directly related to the ability of proteins to initiate gene transcription. Compare and contrast euchromatin to heterochromatin in the context of transcription. Specifically comment on DNA and protein interactions.
Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
A part of a sequenced chromosome has the sequence (on one strand)ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of thissequence is most likely to take up the Z conformation?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Replication and segregation of eukaryotic chromosomesrequire three functional elements: replication origins, a centromere, and telomeres. How would a chromosome be affected ifit lacked (a) replication origins or (b) a centromere?
Complete the complementary strand: DNA replication ATTCGAGGCTAA
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
11. Regarding nucleosome structure, which of the following statements is correct? A. Nucleosomesare spherical structures comprised of RNA, nonhistone proteins and histoneproteins. B. Themajor histones comprising nucleosomes are H1 and H4. C. Nucleosomes permit efficient packing of DNA to about one seventh its normal length. D. Thehistone associated with the DNA in the linker region holding nucleosomes iscalled H2A. E. Allof the above. 12. Which of the following is a part of the promoter of a tRNA gene in eucaryotes? A. INR B. boxA C. TATAbox D. upstream control element E. response elements