Q: what does Priming Perspectives and Amplifying Advancements in genescape means
A: The question is posted in biology, I am assuming the question is about relational database…
Q: Please answer all the questions A Half-life of a hormone is a.the length of time it takes to…
A: The study of chemical reactions that take place within and relate to live beings is known as…
Q: Draw a diagram of the receptor potential formation in mechanoreceptors of the skin - Fater-Pacini…
A:
Q: Use the information in the tables below to determine the most probable number of bacteria per 100 mL…
A: Given Number of positive tube 0.1 ml = 4 0.01 ml = 1 0.001 ml = 0
Q: For the Biosynthetic-secretory pathway, Endocytic pathway and Retrieval pathway: • Where do the…
A: There are two biosynthetic secretory pathways- the regulated pathway and the consecutive pathway. In…
Q: Based on the a graph, why did the number of wolves increase?
A: Population The similar type of species living together in an ecosystem and can breed is known as…
Q: Is natural selection random with respect to fitness?
A:
Q: features that suggest the Cnidaria and Ctenophora share. Outline the features that distinguish these…
A: Cnidaria and Ctenophora are two phyla belonging to the kingdom Animalia. Cnidarians are named so…
Q: Phospholipids (Which is charged, what is the functional significance? Are they preferentially…
A: Phospholipids are biomolecules that are composed of glycerol, phosphate group, and lipids/ fatty…
Q: If you looked at H&E staining of a fungal-infected mouse tongue vs a non-infected mouse tongue,…
A: H& E stands for Hematoxylin and Eosin stain.This stain is used to observe various cellular…
Q: Northern blots are valuable tools to analyze the mRNA level present in a sample. Describe an…
A: The goal of a northern blot is to monitor the expression of a particular genome in tissues, organs,…
Q: 9. Explain how sweating when hot OR shivering when cold are examples of a negative feedback system…
A: Positive feedback occurs to increase the change or output: the result of a reaction is amplified to…
Q: Which of the following systems is predominantly stimulated by nicotine action in parasympathetic…
A: Introduction: The smooth and cardiac muscles are innervated by the nerves that make up the ANS. The…
Q: Anatomically, the motor endplate potential is characterized by synaptic boutons active zones O…
A: Motor endplate-The specialized postsynaptic area of a muscle cell(myocyte). The motor endplate lies…
Q: 8. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…
A: A buffer system is important for a living thing as it helps to maintain a constant chemical internal…
Q: 1. A diploid species has 3 pairs of chromosomes in its somatic cells. In males, the first pair is…
A: DNA is present in the cell nucleus. In cell division, the DNA is condensed to form a unique…
Q: Differentiate between the roles of the superior vena cava and the inferior vena cava.
A: Superior and inferior vena cava are the two main veins of the body that drain deoxygenated blood…
Q: Differentiate between the roles of the pulmonary trunk and the aorta.
A: Introduction The muscular heart of a human being has four chambers and is in charge of pumping blood…
Q: In the CNS which ones are the most common morphological synapse types active during synaptic…
A: The Neurons in the CNS receive thousands of synaptic inputs from other neurons. This information…
Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…
A: A trait is a characteristic feature that is unique to particular individual . Each trait is…
Q: Answer exhaustively, why are the protein receptors on the egg cell particularly important among…
A: Introduction :- A male organism's sperm fertilises a female organism's egg outside of the female's…
Q: Outgroups are used to polarsise characters. Select one: True or False
A: Introduction: Cladograms are tree-like diagrams that can be used to show the links between creatures…
Q: Define "synapomorphy" and "symplesiomorphy".
A: Animals are classified on the basis of similarities and dissimilarities. Cladistics recognises two…
Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.
A: According to their shared evolutionary parent, distinct species of animals with similar structure,…
Q: Write a summary: Simply put, a lab report is a way to explain what you have done in an experiment.…
A: "Research" is the process of researching and evaluating many elements of a problem to find a…
Q: Approximately O 90 60 30 10 % of chromatin is actually composed of DNA.
A: Thread like coiled, elongated structure, present in nucleoplasm and stained with basic stain and…
Q: Are the similar structures among vertebrate species during embryogenesis homologous structures?…
A: The existence of similar structures in different species is one of the most important pieces of…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Construct a cladogram showing possible evolutionary relationships among: Cnidaria Porifera…
A: Evolution The change in heretible characteristics of a species over upcoming generations is known…
Q: Which of the following proteins will CERTAINLY have quaternary structure? Select one: a. autophagy…
A:
Q: In fruit flies, red eye color (R) is dominant over brown eye color (r). Two red-eyed fruit flies…
A: The offspring of two parents can be different from both parents as new allelic combinations can be…
Q: Question 9 of 14 Which of the following acts as a signal for the dendritic cell to begin…
A: Cross-presentation is the process by which specific MHC class I-expressing professional…
Q: The fossil record shows that the first mammals evolved 220 million years ago. The supercontinent…
A: Fossils are the remains of ancient or former living organisms whose biological evidence suggests…
Q: How are the ancestors of modern whales different from their present form?
A: Ancestors are people in your family who lived a long time before you. Ancestors evolve during their…
Q: 1. 1. 4. 6.
A: At the cellular level, cell division drives the mechanism of reproduction. With exception of germ…
Q: Question 12 Which of the following are true about the properties of enzymes? (select all that apply)…
A: Enzymes are proteins that act as biological catalysts by accelerating chemical reactions.
Q: interpret the following ABG: pH= 7.7 paCO2= 30 paO2= 70 HCO3= 32…
A: Introduction When dissolved in water, chemicals known as electrolytes acquire a natural positive or…
Q: "Biodegradation of Diesel Oil Using Bacillus Isolates" Environmental pollution is now a worldwide…
A: Pollution refers to garbage and contaminants that enter our ecosystem. This pollution has a…
Q: briefy explain 3 examples of pseudoscience that are related to evolution, or which discredits…
A: Introduction: The words "pseudo" and "science" are combined to form the definition of pseudoscience;…
Q: where would the energy this products claims to provide come from?
A: Cellular respiration is a metabolic pathway by which the consumed complex sugars molecules are…
Q: What is the signaling pathway that mediates the organizing activity of the A/P organizer in the…
A: In Drosophila a morphogene i.e. DPP is responsible for the development of wing precursors. DPP gene…
Q: Compare and contrast the operation of Optical microscopy and TEM in terms of Abberations
A: Microscopes are widely employed to produce a magnified view of the materials. Magnification refers…
Q: 6. When comparing genes that are conserved between species, the exons are more likely to be related…
A: Exons are nucleic acid coding sequences that are found in mRNA. Introns are non-coding sequences…
Q: Discuss primate evolution before Sahelanthropus.
A: Man is the result of evolution. As a result, human evolution is intrinsically related to the origin…
Q: 9. Which one of the following histones is a component of the core particle? A. H1 B. H2A C. H2B D.…
A: In 1868, Swiss physician Friedrich Miescher extracted nucleic acids from the nucleus of white blood…
Q: E. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…
A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…
Q: In systemic circulation, arteries carry blood from the ____________ to the ______________. Veins…
A: Systemic circulation carries oxygenated blood from the left ventricle, through the arteries, to the…
Q: Similarities which have arisen independently in two or more organisms that are not closely related…
A: Evolution is the process of changes which an organism develops with change in the various…
Q: Explain why there is no arrow that shows carbon atoms gojng from the soil to the tree based on the…
A: Carbon cycle is the movement of carbon atoms from atmosphere into organisms and plants and back to…
Q: What is a likely evolutionary advantage of sexual reproduction over asexual reproduction?a. sexual…
A: Sexual reproduction is the process that involves gamete formation and fusion of male and female…
How understanding fish physiology be helpful in marine conservation and fisheries?
Step by step
Solved in 4 steps
- How do tunas adapt in zonesWhat is migration? List down the factors affecting fish migration and how each factor affect fish migrationMuro-ami is a fishing method where the fishes are driven out of a coral reef by pounding the corals with a heavy weight, or simply by breaking the corals. Then the fishes are guided into the nearby fishnets. - Is Muro-ami illegal? Why?- Cite at least two ways by which the different sectors of the society can help in the protection and conservation of fishes.
- What is the importance of studying Capture Fisheries subject?Distinguish between the ideal conditions for growing warm water fish and cool water fish.what is the impact of or the importance of the study about IOT based Aquaponics Monitoring and Automated Control System/simple aquaponics to the Fish and Aquatic Resources Community