9. Explain how sweating when hot OR shivering when cold are examples of a negative feedback system AND how the birthing process OR masturbation are examples of positive feedbacks mechanisms. Don't forget to explain how both feedback systems work within our body to maintain homeostasis.

9. Explain how sweating when hot OR shivering when cold are examples of a negative feedback system AND how the birthing process OR masturbation are examples of positive feedbacks mechanisms. Don't forget to explain how both feedback systems work within our body to maintain homeostasis.

Fundamentals of Sectional Anatomy: An Imaging Approach

2nd Edition

ISBN:9781133960867

Author:Denise L. Lazo

Publisher:Denise L. Lazo

Chapter1: Introduction

Section: Chapter Questions

Problem 5RQ: The plane running vertically or longitudinally from right to left, dividing the body into equal...

See similar textbooks

Related questions

Q: Severe vomiting and diarrhea cause a loss of water and solutes from extracellular fluids. If the…

A: Vomiting in diarrhoea results in loss of excess fluid from the body. Solution that is best for such…

Q: Explain the role of Antidiuretic hormone ( vasopressin ) in water intox

A: The hormone secreted by the posterior lobe of pituitary gland that acts on the kidney to regular the…

Q: For the pedigrees below, name the inheritance pattern of the depicted disorder: If more than one…

A: Introduction : A pedigree chart is a diagrammatic flow chart designed to display a person's genetic…

Q: Waste & dead matter Heat द -COMPOSERS Heat Heat Heat Heat Quaternary consumers Tertiary consumers…

A: Ecological pyramid - An ecological pyramid is a graphical representation, that shows a relationship…

Q: Question 4 All land plants produce. by mitosis and ____________ by meiosis. A spores; gametes B…

A: Reproduction is a biological process of sale perpetuation in which the grown up individuals give…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: The neuroglia in the CNS comprise all these cells, EXCEPT Schwan cells Microglia Astrocytes…

A: Note: Question 2 is graded and so can't be answered!! Introduction Glial cells, also known as…

Q: Objective: using the outcome of genetic crosses, determine whether a mutations that cause the same…

A: Given All three are mutants Cross of 1 and 2 = complement Cross of one and 3 = non complement

Q: 3. Carbon Cycle and Energy Flow Use your understanding of food webs, photosynthesis, cellular…

A: Atmospheric carbon dioxide is used by the plants and converted in the plants in such a way that is…

Q: Explain how acellular microbes and cellular microbes are classified into groups according to…

A: Microorganisms are very tiny organisms that are visible only under microscope. There are large…

Q: Aside from skeletal structural similarities, what other commonalities among organisms might be…

A: Evolution is the process of accumulation of genetic variations in individuals that lead to the…

Q: "In a beaker containing 6% NaCl, you place a cell which contains 0.9% NaCl. NaCl doesn t cross the…

A: Introduction : Osmosis is a passive process and happens without any use of energy. It involves the…

Q: 8.27 x 11.69 in 5 / 7 Taxonomy O Kingdoms of Classification k I Binomial Nomenclature Cladistics…

A: Introduction: There are numerous types of plants and animals in the living world. The structural and…

Q: What may be expected to happen chromosomally and genetically to: a chromosomes that contains two…

A: The genetic material in the cell is DNA. It is present in the nucleus of the cells in the form of a…

Q: Name one of the differences between neurotransmitters (non-peptides) and neuropeptides.

A: Introduction: Chemicals known as neuropeptides and neurotransmitters serve as intermediaries for the…

Q: Identity gene 1 (bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identity gene 3 ( bl,pr, vg) How many map…

A: The three point test cross is used in this table. The greater numbers are parental progenies. The…

Q: Consider the graph below. Illustrated is the proportion of attacks on four different colored insects…

A: Fitness can be defined in term of survival rate.Individuals which have higher survival ability and…

Q: Phospholipids (Which is charged, what is the functional significance? Are they preferentially…

A: Phospholipids are biomolecules that are composed of glycerol, phosphate group, and lipids/ fatty…

Q: Columbia CNA with 5% Sheep Blood Agar is undefined, differential and selective. Which ingredient…

A: INTRODUCTION Columbia sheep blood agar This is the 5% sheep blood agar used for the isolation of…

Q: What are cellular membranes mostly made out of? Choose the best answer. O Lipids and proteins O…

A: Introduction :- All cells have a cell membrane, also known as a plasma membrane, which separates the…

Q: State one example of an emergent property. Describe how a feature of the whole is not observed in…

A: Introduction : Emergent properties are characteristics that show up as a result of different system…

Q: Please define the term closed circulatory system. Which animals have it, and what are its’…

A: The circulatory system is the system that transports blood, gases, nutrients, wastes, and lymph.

Q: Choose only one which is the correct? Which of the following best describes a trait of life? Trees…

A: 1) Trees that are able to produce fruits : The trees produces fruits due to influence from…

Q: How do the daughter cells formed by mitosis compare genetically to each other? 2. How would you…

A: Mitosis means threads and threads refers to the chromosome. Thus the chromosome division takes place…

Q: Cell membranes are described to be fluid mosaics. What does that mean? Are all membranes components…

A: The creators of the fluid mosaic model are S.J. Singer and Garth L. Nicolson. According to this…

Q: What seems to be a common occurrence with all mass extinction events? Rising CO2 Rising water pH…

A: Introduction The word "extinction" refers to the end of a particular type of organism or a set of…

Q: The mathematical shape of the earth can be made as: a. Flat b. Almost any shape such as spheroid…

A: Introduction : Earth is an oblate spheroid. This means it is spherical in shape, but not perfectly…

Q: The basic geography of California from West to East is this:

Q: ntify each stage of mitosis shown below: a. LM (1600x) b. LM (1600x) C. LM (1600x) d. LM (1

A: Introduction : Cell division is the process through which a cell matures and divides after a…

Q: In the same cross as question #1, what fraction of the offspring will have their father's genotype…

A: Genotype The genetic makeup of a individual is known as genotype.

Q: 1.Give similarities a. ecologist vs. environmental scientist b. ecologist vs.…

A: The environment is very important in life. It is a necessary element of our lives. A clean…

Q: Why is figuring out net photosynthesis important? Does it help keep track how healthy an environment…

A: Photosynthesis The mechanism by which plant make their own food in the presence of light.

Q: Classify and characterize the plant-like protists (algae) based on the following parameters.…

A: Note: As Per Guidelines, we can answer 3 sub-parts of a question at one time. Please ask rest…

Q: Briefly explain the difference between Wright Staining and H&E Staining (why use one over the other)

A: Staining is defined as a technique ,which is utilized for increasing the contrast in biological…

Q: 15. If a man with blood type B, who has one parent with blood type O, marries a woman with blood…

A: In humans, ABO blood is usually controlled by gene I. The kind of sugar polymer present on the…

Q: In what ways is a eukaryotic cell like a chemical factory? Select all that apply, It has metal pipes…

A: Eukaryotic cell - Eukaryotic cell are the complex cellular structure that contains…

Q: How do microtubules act as a cytoskeleton? Are there times when they are particularly abundant?

A: A intricate web of protein filaments called the cytoskeleton is found in the cytoplasm of cells. It…

Q: Discuss the three ways by which natural products can be developed and utilized as drugs. which is…

A: Nutrients are substances that are required by the body for nourishment and growth. Depending upon…

Q: Sketch and label a geologic time scale. Include dates of the following events in Earth History on…

A: First of all let's prepare and analyse the events in The form of concept sketch. The events given in…

Q: Compare and contrast the operation of optical microscopy and TEM in terms of Magnification

A: Microscopes are instruments that allow the observation of small structures that can't be seen with…

Q: 1. Hot, sulfur-rich environments where certain groups of Archeabacteria thrive 2. Light-sensitive…

A: Archaebacteria are separate group of Bacteria which are the ancient microorganisms that were present…

Q: why is fluid mosaoc model called "fluid mosaic model" ?

A: Introduction :- Different facts on the composition of functional cell membranes are explained by the…

Q: 3. In the absence of the channel of straight connection the activity of a contour of biological…

A: Regulation In biology, regulation means to control the process that take place inside an organism.

Q: State one example of an emergent property. Describe how a feature of the whole is not observed in…

A: Emergent property In biology, it means to understand the fundamental and functional properties of…

Q: Do 2 3 and 4

A: According to the Chegg policy, we will answer question 2 only.

Q: Organisms have the following genotypes. What types of gametes will these organisms produce, and in…

A: Introduction : All sexually reproducing organisms have sex cells called gametes. The gamete produced…

Q: Where would you expect to find ependymal cells? in the deep nuclei of the brain O in the peripheral…

A: Ependymal cells:- it is one of the glial cell found in brain. It is ciliated epithelial glial cell…

Q: According to Schmidt's theory of motor control, which of the following would be controlled by the…

A: Introduction Schmidt's theory of motor control claims to solve the degrees of freedom problem in…

Q: Differentiate the Cimex sp. versus Ixodes sp. based on their morphology, ecology and/or behavior

A: Introduction: Insecta is an important class of the phylum Arthropoda. Some of their characteristics…

Q: Other than salinity, what other parameters can a refractometer measure? How is it different from…

A: Salinity is the saltiness or amount of salt dissolved in a body of water, called saline water.It is…

Question

9. Explain how sweating when hot OR shivering when cold are examples of a
negative feedback system AND how the birthing process OR masturbation are
examples of positive feedbacks mechanisms. Don't forget to explain how both
feedback systems work within our body to maintain homeostasis.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

feedback mechanisms

VIEW

examples

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The central region of the nine abdominopelvic regions is the a. inguinal. b. epigastric. c. lumbar. d. hypochondriac. e. umbilical.
1. What category of women drinks during pregnancy and list the reasons while they drink.
A plane that divides an animal into dorsal and ventral portions is. sagittal midsagittal coronal transverse
The plane running vertically or longitudinally from right to left, dividing the body into equal anterior and posterior parts, is the a. oblique. b. midcoronal. c. midsagittal. d. horizontal.
Negative feedback occurs when ______. A Na+ entry through voltage-gated channels stimulates more voltage-gated channels to open B oxytocin secretion in response to stretching of the cervix causes the uterus to contract C platelet activation in response to blood vessel damage stimulates further platelet activation D heat production through shivering increases the body temperature and stops shivering
1. A newborn male infant presents to the healthcare clinic for a well-care examination. The mother requests circumcision for the child. During the genitourinary assessment, the healthcare provider notes that the urethral opening is on the dorsal aspect of the penis.di it quickly answer?a. What type of genitourinary defect does this child have?b. Should the child receive circumcision at this time? Why or why not?c. What are the postoperative priority nursing interventions for this patient?
1. How do breastfeeding and feeds of breasts milk benefit Noah?
2. Trace a drop of blood from the human's thumb of the right hand to the antecubital surface of the left arm (include heart and lungs)
1. it controls the processes in the reproductive system a. ovary b. pituitary c. corpus luteum d. follicle
16. Identify each event found below as a homeostatic response or not a homeostaticresponse. Remember to give the rational for each response. a) A marathon runner is sweating as she completes 10 km of a 20 km race b) Children at a party enjoy eating the chocolate cookies and finish everything on theplate.
1.Which of the following is true about the physical development that occurs to children between ages 6 and 11? a. The average 10-year-old girl weighs under 50 pounds. b. The average 10-year-old boy weighs under 60 pounds. c. They grow about 7 to 8 inches each year. d. They double their weight during this period.
Which of the following is an example of negative feedback?a. Uterine contractions increase as labor progresses.b. Insulin decreases blood sugar levels after a meal is eaten.c. Sweating increases as body temperature drops.d. Platelets continue to plug an opening in a blood vessel untilblood fl ow stops.