Q: Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5'…
A: Introduction : The genetic code is a collection of rules that living cells use to decode the…
Q: types of careers that are required to develop and operate indoor vertical farming.
A: INTRODUCTION Indoor vertical farming Growing crops in a greenhouse in vertically stalked layers.
Q: Name one of the differences between neurotransmitters (non-peptides) and neuropeptides.
A: Introduction: Chemicals known as neuropeptides and neurotransmitters serve as intermediaries for the…
Q: Write only the class that exhibits the following characteristics
A: All marine creatures perform critical roles in their ecology. Plankton, on the other hand,…
Q: Given the following traits that the parents have, assign the letters H for hair type, E for eyelids,…
A: A trait is characteristic feature that is unique to particular individual. A trait is represented by…
Q: Northern blots are valuable tools to analyze the mRNA level present in a sample. Describe an…
A: The goal of a northern blot is to monitor the expression of a particular genome in tissues, organs,…
Q: 1) If an animal cell is placed in HYPERTONIC solution, what happens to the cell? nothing happens…
A: Based on osmotic concentration solutions can be of three types namely- hypertonic solution,…
Q: What seems to be a common occurrence with all mass extinction events? Rising CO2 Rising water pH…
A: Introduction The word "extinction" refers to the end of a particular type of organism or a set of…
Q: Describe the endomembrane system: protein modification transport and its functions
A: Introduction Throughout the body, molecules and cells must interact with one another. There are…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…
A: The prokaryotic cells are considered to be ancestors of the eukaryotic. The prokaryotic cell nucleus…
Q: How do organisms with less complex systems such as those in protozoans are able to respond to…
A: Introduction: Stimuli is the a detectable change in the internal or external environment. which…
Q: Name three features often associated with the evolution of an endoparasitic lifestyle. Compare and…
A: -Explanation: Reduced or absent locomotive structures: -Endoparasites from the phylum Nematoda have…
Q: Cnidarians do not have mesoderm. Discuss the costs and benefits of this condition, especially with…
A: Explanation: Cnidarians do not have a mesoderm layer in their bodies. Because of this state, the…
Q: the Highest P... 2019 Summer Inter... Match each of the parts of a eukaryotic (specifically, human)…
A: As per the hierarchy of life, cell is the smallest entity that consists life of its own. It is…
Q: Multiple outgroups confuse the process of polarising characters. Select one: True or False
A: The outgroup is defined as organisms that are far distantly separated from another group of…
Q: Match each type of microscopy to its description Oldest type of microscopy; uses glass lenses to…
A: Microscope is an instrument generally used in laboratories to examine objects that are too tiny to…
Q: All land plants produce. ______by mitosis and ____________ by meiosis. Selected Answer: spores;…
A: Introduction: The haploid and diploid generations of plants alternate during their life cycle. Only…
Q: The key feature of AMPA receptors as demonstrated experimentally is_
A:
Q: How do the “types of vertebrae” change throughout the evolution of vertebrate taxa, from fish (2…
A: Comparative anatomy is the study of the anatomy of more than one species. Rather than focusing on a…
Q: 1.It is known that there is an ionic asymmetry between inside and outside of the cells membrane.…
A: MRP- Membrane resting potential It refers to the voltage across a given cell membrane during the…
Q: What is definition as used in microscopy?
A: Introduction A microscope is an instrument that makes an enlarged image of a small object, thus…
Q: Hoe many organelles does Eukaryote cells have?
A: Ans: Cell is the structural and functional unit of life. And there are millions of cells present in…
Q: 18. Mushrooms belong to which kingdom? O Kingdom Plantae Kingdom Fungi O Kingdom Eubacteria O…
A: Introduction The five kingdom classification was proposed by Robert Whittaker. According to the…
Q: MC In humans, the condition for normal vision dominates color blindness. Both alleles are linked to…
A: Introduction : Inheritance is defined as the transfer of genetic traits from parents to their…
Q: 6. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…
A: pH homeostasis is critical because some enzymes cannot operate if the pH varies from what it should…
Q: How did life most likely originate in the planet? Choose below. - Biogeochemical theory - Special…
A: Introduction Life is eternal and coeternal with matter; it first appeared on Earth at or shortly…
Q: describe and explain 2 physical ways that a human may develop hypertension (abnormally elevated…
A: Explanation: One way that hypertension can develop is if the walls of the blood vessels thicken.…
Q: (A) The above figure indicates how much biologically productive land is needed to support different…
A: Ecological footprint can be defined as the amount of land resources required for sustaining the use…
Q: This diagram shows a small part of a food web. Notice that the food web contains multiple food…
A: A consumer-resource system of the food chain is an important aspect to maintain the balance of our…
Q: Branch, clade and monophyletic group are perfectly synonymous. Select one: True or False
A: Introduction : A phylogenetic tree is a visual representation of the evolutionary connections…
Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.
A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…
Q: Give similarities and differences between the following: a. ecologist vs. environmental scientist b.…
A: Ecology is the study of the relationship and interactions of different components of a habitat. The…
Q: Identify the charges (positive/negative) that appear on the inside AND the outside of an axon while…
A: Neuron Neuron is the basic functional unit of brain and spinal cord.
Q: Waste & dead matter Heat द -COMPOSERS Heat Heat Heat Heat Quaternary consumers Tertiary consumers…
A: Ecological pyramid - An ecological pyramid is a graphical representation, that shows a relationship…
Q: Explain why there is no arrow that shows carbon atoms gojng from the soil to the tree based on the…
A: Carbon cycle is the movement of carbon atoms from atmosphere into organisms and plants and back to…
Q: What is the most likely mode of inheritance? b) If this were a pedigree you did NOT want to…
A: * There are four types of pedigree. They are X linked recessive X linked dominant Y linked…
Q: Objective: using the outcome of genetic crosses, determine whether a mutations that cause the same…
A: Given All three are mutants Cross of 1 and 2 = complement Cross of one and 3 = non complement
Q: Which events or functions in the respiratory system are easily measured by the ergonomist and can be…
A: Ergonomists make sure that the layouts of machines, systems, and buildings offer the greatest…
Q: The gene for tall is dominant over dwarf in the garden pea plant. If a heterozygous tall plant is…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Differentiate the Cimex sp. versus Ixodes sp. based on their morphology, ecology and/or behavior
A: Introduction: Insecta is an important class of the phylum Arthropoda. Some of their characteristics…
Q: Identity gene 1 (bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identity gene 3 ( bl,pr, vg) How many map…
A: The three point test cross is used in this table. The greater numbers are parental progenies. The…
Q: The patient states, "I have gas after I eat spicy foods." The patient complains of what ?…
A: Introduction : The acid in our stomachs is called hydrochloric acid. The oxyntic cells in the…
Q: How the Slow Loris not become the DEAD Loris?Hints :Think about cells, membranes, amino acids,…
A: Slow Loris are the nocturnal primates, which are very small in size and belong to the genus…
Q: Describe the features of the fluid mosaic model of the cell membrane in detail
A: Please follow step 2 for detailed explanation.
Q: Differentiate the following based only on their general external anatomy: Beetles versus True Bugs
A: Insects are invertebrates that do not have a backbone or skeleton inside. They have a hard outer…
Q: 2. List the 4 biologically importance molecules (carbohydrates/lipids/proteins/nucleic acids) and…
A: Introduction : Biomolecules are defined as the organic molecules present in a living cell which…
Q: Differentiate extrafascicular and fascicular water conduction.
A: Cambium is present in dicot plants between the xylem and phloem meristem cells. The primary function…
Q: Home Tools 6weekwomensfull... Nelson Biology 11... ↓↓ 8.27 x 11.69 i 3 / 7 Unit 1- Quiz on Le... x…
A: Introduction :- Eubacteria are prokaryotic microorganisms made up of a single cell without a nucleus…
Q: What is NOT accurate about axonal projections? carries nerve impulses that can be graded in nature…
A: There are a few important points that should be kept in mind. Axonal projections: It is basically…
Compare and contrast the operation of Optical microscopy and TEM in terms of Abberations
Step by step
Solved in 2 steps
- Compare and contrast the operation of Optical microscopy and TEM in terms of Depth of fieldCompare and contrast the operation of optical microscopy and TEM in terms of MagnificationCompare and contrast the operation of optical microscopy and TEM in terms of Brightness Note: Wherever possible, explain what factors affect or control each features
- What are the differences between phase contrast microscopy and differential interference microscopy?Explain differential-interference contrast (DIC) microscopy.Compare and contrast the operation of optical microscopy and TEM in terms of Contrast (explain all different types for each microscopy) Note: Wherever possible, explain what factors affect or control each features.