→ 읊 https://openvellum.ecollege.com/course.html?courseld-15183778&HepID=fb9c...☆ @ Pearson Copyright O 2019 Pearson Education Inc. All rights reserved. | Terms of Use | Privacy Policy Permissions I Contact Us

→ 읊 https://openvellum.ecollege.com/course.html?courseld-15183778&HepID=fb9c...☆ @ Pearson Copyright O 2019 Pearson Education Inc. All rights reserved. | Terms of Use | Privacy Policy Permissions I Contact Us

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Which of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…
Which of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.
Like DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side of the Gizmo will successfully pair with the thymine at the top of the template strand of DNA. (NOTE: The DNA on the right side is the template strand.) Which RNA base bonded with the thymine?
Which of the following statements about the DNA double helix is FALSE? O The base pairs are located in the center of the helix O The plane of the base pairs is perpendicular to the direction of the deoxyribose- phosphate backbone O The two strands have the same 5' to 3' direction (i.e, are parallel) O The base pairs stack on one another O The deoxyribose-phosphate backbone is on the outside of the helix
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 311. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion…
The DNA double helix looks like a twisted ladder.What makes up each rung of the ladder?What holds the rungs together at the base? Describe its structure and its component.
DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA molecule below to show what the two semi-conserved strands would look like. A G T A C C G G G C A A A C T G C A T T G T G I I I I I I I I I I I I I I I I I I I I I I I I I I T C A T G G C C C G T T T G A C G T A A C A C old strand A G T A C C G G G C A A A C T G C A T T G T G new strand: new strand: old strand T C A T G G C C C G T T T G A C G T A A C A C Gene Expression: 2. Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA:
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?
Franklin's X-ray crystallography work provided which of the following regarding the structure of DNA? (more than one answer may be correct so check all that apply) A It had a helical structure with more than one strand A complete helical turn is made after 20 bases O It replicates in a semi-conservative manner Purines are paired with pyrimidines