Identify a fact about the urinary (disorder, anatomical structure). Describe some details to expand on the disorder, the function of the structure or fact.

Q: (3) a. The characteristics of water molecules to maintain a continuous column of water is : a. Root…

A: Xylem and phloem facilitate the transportation of water, minerals and food throughout the plant.

Q: QUESTION 6 In bryophytes, the gametophyte is O the dominant generation O dependent on the sporophyte…

A: Bryophytes are plants placed under Phylum Bryophyta. Bryophytes lack true stems, leaves, or roots.…

Q: Consider the mating between two carriers for the recessive allele that causes albinism, Aa x Aa.…

A: A carrier is referred to as a person who has a change in only one gene pair and the other gene of…

Q: A student plates 100 µL of a 107 dilution of E. coli culture on a Luria Agar plate. After 24 hour,…

A: The bacterial sample when taken from the stock solution, it may contain lots of bacterial cells, and…

Q: Why are there three layers of stomach muscle and how do they function?

A: The stomach is J shaped organ that is present in the upper abdomen on the left side of the body. The…

Q: Mother = 2) Child ||| 16. 'Dad' 1 'Dad' 2 || 9) FAC 9) 'Dad' 3 Source:…

A: DNA fingerprinting or profiling refers to any DNA-based technique that identifies DNA from a…

Q: If a variety of seaweed reproduces only through mitosis, this would be considered is "asexual…

A: Seaweeds reproduce in various ways. Lower types of Seaweeds reproduce  asexually. Further developed…

Q: Which of the following differentiates meiosis from mitosis

A: Cell division help in growth and development. Mitosis and meiosis are different types of cell…

Q: Glycolysis, which can occur in all living cells, correctly occurs in the cell structure _____, and…

A: Glycolysis is also known as EMP pathway (Embden - Meyerhof Pathway). It is a universal process. It…

Q: A certain species of animal has 18 chromosomes in its diploid cells (2n=18). Describe what the…

A: Introduction Strasburger 1875 first reported the presence of chromosomes in eukaryotic cells. The…

Q: Which of the following statements does NOT correctly describe the role of inhibin in the male…

A: Introduction :- The biological system made up of all the anatomical organs involved in sexual…

Q: A diploid male organism has two homologous chromosomes. A and B are from its maternal parent, while…

A: Introduction Mitosis and meiosis are cell division proces. Mitosis results in cloned cells while…

Q: Is the population in Hardy Weinberg equilibrium? (show your work) In your answer, describe what this…

A: Introduction Evolution is a continuous process involving a change in organisms/ individuals to…

Q: 8. Water regulation Describe how the body regulates water. In your answer include: the name of the…

A: The balance between water intake and excretion is necessary for homeostasis. The majority of water…

Q: Consider two species A and 8, with natural growth rates FA = 2 and r8 = 4 respectively, and natural…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…

A: Interbreeding It refers to the breeding of organisms with another organism of different species.…

Q: Please answer fast

A: Rubisco is an enzyme with full form Ribulose 1, 5-bisphosphate carboxylase/oxygenase. This enzyme…

Q: When the mammalian brain compares the actual temperature of the body to the preferred temperature of…

A: The cerebrum, brainstem, and cerebellum make up the brain. It is in charge of the majority of the…

Q: TRUE OR FALSE: asap Digestive secretions from the small intestine complete the digestion of…

A: Digestion is the process by which large insoluble food molecules are broken down into small…

Q: Discuss measures you would consider taking to prevent occupational transmission of diseases from…

A: Introduction Diseases that can be spread from one person to another by air or physical contact are…

Q: The picture shows the different stages in the life of a pea plant. Which characteristic of living…

A: Introduction  A plant is a living organism of the type represented by trees, shrubs, herbs, grasses,…

Q: B. Draw and label the cross section of the cat ovary (using HPO). Label all the oogenic cells. C.…

A: The organs of female reproductive organs produce female sex cells that are egg cells or ova. There…

Q: True or false. The cell walls of plants prevent the process of cytokinesis.

A: Cytokinesis is the process by which one cell physically divides into two cells.

Q: In fruit flies a dominant mutation on the X chromosome causes the eye to be oval instead of round.…

A: Introduction :  Gene is a unit of heredity. It contains the genetic information. It is made up of…

Q: what happens to the field of view as magnification is increased useing shccdssively higher power…

A:

Q: Describe Narwhals and state some great facts and interesting trivias about them.

A: Narwhals It is a medium sized toothed whale.   It possess a large tusk from the protruding canine…

Q: Select one: a. glucose.

A: Respiration is an essential chemical activity carried out by all living creatures, including plants,…

Q: The lips are muscular folds forming the anterior boundary of the oral cavity. A mucous membrane…

A: Vermilion border is a major feature of  lips in human beings,as it is absent in any other…

Q: Which of the following characteristics is shared by all types of muscle tissue?   Question 5…

A: Introduction: Movements in the human body are controlled by muscle cells. Involuntary and voluntary…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What are the major cells involved in bone resorption?

A: During resorption of bones, some specialized cell break down the bone tissue. This releases calcium…

Q: Identify a disorder/disease/condition that is either a result of poor nutrition or improper…

A: The food is required to maintain the nutritional requirement of the body. The deficiency of a…

Q: is a substance secreted by cells in the lungs that reduces surface tension.

A: The alveoli are the tiny air sacs in the lungs where gas exchange happens. And there Walls are lined…

Q: Question 2: Calculate the Mid-Parent, Better Parent and Economic heterosis for plant height from the…

A: Heterosis, also called outbreeding enhancement or hybrid vigour, is the improvement of function or a…

Q: Answer the following:  1. Why should a scientific name be written in Latin?

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Always begin examing microscope slides with which power objective?

A: A microscope is an instrument of immense importance in a biology/ microbiology laboratory. As the…

Q: n your own words, explain the factors that lead to the Phenotypic variation andits importance to…

A: Evolution is a change in the frequency of alleles in a population over time. These alleles are the…

Q: 1. For each of the diploid genotypes presented below, determine the genetic make up for all of the…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: In humans, 2n = 46. What is number of chromosomes and DNA molecules in a skin cell nucleus at G1 of…

A: Introduction :- The thread-like components known as chromosomes are found in the nucleus of both…

Q: Calculate the melting temperature of this primer and estimate the annealing temperature of this…

A: Introduction PCR (polymerase Chain Reaction) is a molecular technique by which multiple copies of…

Q: I need help questions

A: We know that The repository system has the main function to inhale oxygen and exhale carbon dioxide.…

Q: How do the skin blood vessels and sweat glands regulate body temperature?

A: The skin blood vessels regulate body temperature by- During hot climate or when the heat is more…

Q: which of the following is true about the immune system? check all that apply. a. cd8 t cells…

A: Introduction The main function of the immune system is to protect us from foreign substances and…

Q: A. B. C. D. ATGTTCGCG What type of mutation is seen in this example? Substitution point mutation…

A: Q8. Mutation is a change in the sequence of DNA. It can result due to errors during replication of…

Q: Structure of globin mRNA

A: The cell consists of the genetic material, which can be either DNA or RNA. DNA is the…

Q: Check this 1 1 1 1 1 deciliter centiLiter milliLiter microLiter nanoliter (dL) (CL) (mL) (mL) (NL)…

A: Introduction A unit is a numerical way of expressing physical quantity such as weight, length, and…

Q: __________ is a substance secreted by cells in the lungs that reduces surface tension.

A: Introduction :  Chemical substances known as surfactants are employed to reduce the surface tension…

Q: Which of the following cellular features are common to all classes of cells? A. Presence of genetic…

A: Cell is the smallest unit that can live on its own and that makes up all living organisms and the…

Q: Compare the different hierarchical organizations and/or animal body plans across different animals.…

A: Introduction  On Earth, there are around 1.7 million different species of creatures. These are…

Q: 11 The diagram below shows a 'bathtub' analogy which is often used to help explain the…

A: Introduction :  The study and analysis of the distribution, patterns, and causes of health and…