TRUE OR FALSE: asap Digestive secretions from the small intestine complete the digestion of carbohydrates, proteins, and lipids. Bacteria in the large intestines produce minerals and nucleic acids.

Q: Adaptations for low oxygen in – inverts, goldfish, turtles

A: Inverts:- all those organisms lacking vertebra column comes under the category of inverts i.e.…

Q: Explain how the different glands work together to maintain homeostasis

A: Homeostasis is any self-regulating process by which an organism maintains stability while adjusting…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: a. Make a Venn Diagram to differentiate the exclusive and common organelles in both plant and animal…

A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…

Q: Other than bacteria list the other 6 types of Microorganisms listed in your textbook.

A: Introduction R. H. Whittaker’s classification system divides organisms into five major groups. These…

Q: Bacterial binary fission is proof that cells arise from pre-existing cells.  True  False

A: Introduction :- In biology, fission is the division of a single organism into two or more pieces,…

Q: If a variety of seaweed reproduces only through mitosis, this would be considered is "asexual…

A: Seaweeds reproduce in various ways. Lower types of Seaweeds reproduce  asexually. Further developed…

Q: _____ tissues are sheetlike with one free surface. a. Epithelial c. Nervous b. Muscle d. Connective

A: Tissues are the group of cells that are determined to carry out a specific function. These are of…

Q: Proposal 1. In biology courses: Disease and illness are to be explained as being caused by…

A: Introduction :- According to the germ theory of disease, microorganisms like bacteria, viruses,…

Q: Which of the following describes the effect of the venom on the prey of the cobra?

A: Introduction Muscle contraction is a result of action potential generated by depolarization,…

Q: 1.Which is the correct statement: Speed of protein synthesis > speed of protein folding Speed of…

A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…

Q: Which of the following organism classification is based on free energy sources? A. lithotrophs B.…

A: Introduction All living organisms require energy for their metabolic process. Some organisms (green…

Q: The difference between whole body metabolic rate and weight specific metabolic rate. How does…

A: Allometry is an important method for describing morphological evolution. It is the relation between…

Q: Identify a disorder/disease/condition that is either a result of poor nutrition or improper…

A: The food is required to maintain the nutritional requirement of the body. The deficiency of a…

Q: How does osteoporosis differ from osteomalacia? Name three differences.

A: Introduction Vitamins are the organic micronutrients needed in small quantities by our body for…

Q: How do pancreatic beta cells differ from acinar cells?

A: Pancreatic beta cells are present in the core of the islet. Beta cells are endocrine cells that…

Q: Changes in environmental conditions can render previous adaptations as maladaptations. Describe an…

A: A maladaptation is a trait that is more harmful than helpful in evolution, as opposed to an…

Q: Describe the parts of an atom and where they arefound within the atom.

A: Atom is the smallest part of an object and is made up of different parts that determines the overall…

Q: How long would the peptide be that is translated from this mRNA sequence: AUGGGCUACCGA ?   Group of…

A: Introduction :- In molecular biology, messenger ribonucleic acid is a single-stranded RNA molecule…

Q: Expla (MRI device) 1. What are the ingredients? The device? 2. The working principle 3. What common…

A: MRI stands for magnetic resonance imaging. Magnetic Resonance Imaging (MRI) is a non-invasive…

Q: Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the…

A: Inheritance of eye colour It is autosomal trait  and the inheritance is of Autosomal recessive. The…

Q: Write a 1 paragraph summary of the wildlife alert on preserving genetic diversity

A: Introduction Genetic diversity is the wide variety of different traits passed on from ancestors in a…

Q: What is the respiratory quotient?  How is it used to study metabolic rate and the food that was…

A: Respiration is a metabolic phenomenon takes place inside the living organisms in which oxygen enter…

Q: 4. Use what you know about the anatomy and physiology of special sensory organs to evaluate how each…

A: we will be discussing how different changes in an animal's anatomy and physiology can impact its…

Q: 7.) A liver extract is capable of carrying out all of the metabolic reactions invo gluconeogenesis.…

A: Gluconeogenesis is a metabolic pathway that results in the production of glucose from…

Q: Which of these discoveries were used by paleontologists to conclude that some hominins—Homo erectus,…

A: The species H. erectus is extremely diverse, which is not surprising given its long existence and…

Q: In which type of classification system are names assigned only to groups that include a common…

A: Scientists must assign names to each organism in order to investigate the enormous diversity of life…

Q: QUESTION 6 In bryophytes, the gametophyte is O the dominant generation O dependent on the sporophyte…

A: Bryophytes are plants placed under Phylum Bryophyta. Bryophytes lack true stems, leaves, or roots.…

Q: Consider the mating between two carriers for the recessive allele that causes albinism, Aa x Aa.…

A: A carrier is referred to as a person who has a change in only one gene pair and the other gene of…

Q: Write the overall photosynthetic reaction and identify which molecules are oxidized and which…

A: Photosynthesis is the process by which green plants synthesize their food by using light energy.…

Q: gene 2 seems to be expressed at higher levels than gene 5. Justify the claim that the two genes have…

A: The process by which a cell produces molecules based on the direction of the DNA is called the…

Q: How could control of the glow trait be ultimately determined?

A: Introduction Genes are the hereditary units present on the chromosomes, these genes encode specific…

Q: Assuming the technology and expertise is ready and available, which specific human/animal/world…

A: Introduction Unlike eukaryotic cells in plants and animals, prokaryotic cells such as bacteria and…

Q: ARVCS is a disorder characterized by the replacement of healthy heart tissue with fatty fibrous…

A: Mutation is any change in the nucleotide sequence of the gene. It may lead to disorders if it makes…

Q: Why is it important to study evolution?

A: Change in the inheritable traits of biological populations over successive generations is referred…

Q: List three major steps that are hypothesized to have occurred in the evolutionary history of…

A: Photosynthesis occurs in plants and some green algae. This occurs due to the presence of chlorophyll…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: In fruit flies a dominant mutation on the X chromosome causes the eye to be oval instead of round.…

A: Introduction :  Gene is a unit of heredity. It contains the genetic information. It is made up of…

Q: Fast fast fast

A: Introduction The cells are so minute structures that we cannot see them with unaided eyes, we…

Q: Match the description with the correct term. the idea that different mating calls of birds used…

A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…

Q: Rank the relative size of the gametophyte generation in the following plant lineages: Bryophyte…

A: Plants show alternation of generation where they complete their life cycle in two phases - a diploid…

Q: In the life cycle of a bryophyte, the sporophyte is nutritionally Dependent or Independent (circl…

A: Introduction Small, non-vascular plants known as bryophytes include mosses, liverworts, and…

Q: The tetrapeptide Cys-Trp-Lys-Pro was digested with chymotrypsin and adjusted to pH=0.5 to fully…

A: Each protein or peptide is made up of a linear sequence of amino acids. The primary structure of a…

Q: A medical imaging facility is considering the purchase of a positron emission tomography (PET) or a…

A: Mutual exclusivity can be defined as a phenomenon in which two things taken into consideration…

Q: Draw and label x.s. of Amphioxus, amphibian, avian and mammalian clavage and blastula stages. Label…

A: The stage of early animal embryonic development known as blastulation is when the blastula is…

Q: In fruit flies, yellow body is a sex linked recessive allele. The dominant allele is dark bodied. If…

A: This is the chart showing genotype as well as phenotype of the parent fruit flies.    Q1. Now with…

Q: hy is the Baermann-Moraes method suitable for a suspect strongyloidiasis? Why is it considered a…

A: Strongyloidiasis is a disease caused the nematode Strongyloides stercoralis. It is believed to…

Q: Identify ways in which landscape preservation is more valuable than ecosystem preservation.

A: An approach to landscape management that considers both nature conservation and economic activities…

Q: In Coleus , the somatic cells are diploid with 24 chromosomes. How many of each of the following is…

A: Mitosis and meiosis are the types of cell division that take place in living organisms. Mitosis is…

Q: What is the function of Kupffer cells?

A: Introduction  Our immune system plays a crucial role in defense against harmful foreign particles be…