Q: A.) Answer the following questions: 1. What is an ecosystem? 2. Identify the different types of…
A: Introduction Ecology is the study of interactions between living things, such as humans, and their…
Q: Need help with question one
A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…
Q: 2. Determine whether the event takes place during INHALATION or EXHALATION. _____1. The diaphragm…
A: Inhalation and exhalation are how your body brings in oxygen and gets rid of carbon dioxide.
Q: How are fractures classified?
A: Fracture is defined as the complete or partial break in a bone.Fractures are caused by direct hit or…
Q: Consider a locus with two alleles (b1 and b2) in a population of bacteria (bacteria are haploid).…
A: The Hardy-Weinberg principle is also known as the Hardy-Weinberg equilibrium or law in population…
Q: Why are there three layers of stomach muscle and how do they function?
A: The stomach is J shaped organ that is present in the upper abdomen on the left side of the body. The…
Q: Which of the following accurately represents proper genotypes for a dihybrid cross? Group of answer…
A: These options represent different types of crosses. In genetics on the basis of the characters or…
Q: What is specific dynamic action? What causes it? How can it influence metabolic rate experiments?
A:
Q: Two parental strains with mean heights of 64.29 and 135 cm. respectively were crossed. The F1 and F2…
A: Polygenes are groups of genes that are expressed together. The character is controlled by multiple…
Q: Compare the different hierarchical organizations and/or animal body plans across different animals.…
A: Introduction On Earth, there are around 1.7 million different species of creatures. These are…
Q: Laws and the Fundamental Theorem of Natural Selection in the process of genetic variability of…
A: There are three Mendel's laws -law of dominance, law of segregation and law of independent…
Q: In 1956, two Corsican mouflon sheep were introduced to Haute Island, which has an area of 7.00 km².…
A: Introduction In reality, there are no unlimited resources that allow unrestricted population growth.…
Q: Please help me understand this question
A: Introduction Biomolecules are generally found in the complex form such as in the polymer stage even…
Q: he Krebs cycle occurs in the Select one:
A: The Krebs cycle or TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle is a sequence of…
Q: __________ is the information scientists collect when doing experiments and making observations.
A: a scientific procedure undertaken to make a discovery, test a hypothesis, or demonstrate a known fa
Q: What do you think will become the top public health concern in 2050, What do you think will become…
A: Answer: Drug-resistant diseases increase day by day. It's major concern for future public health.…
Q: Explain why a complete atom is electricallyneutral.
A: An atom is the smallest unit of body organisation. Several atoms get united to form molecules and…
Q: The study of tissues is called cytology
A: Tissue is defined as group of cells that possess a similar structure and perform a specific…
Q: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a…
A: When two species diverge into two separate species, the copies of a single gene in the two resulting…
Q: Case Study: Case Study: Catalase Activity Catalase HO2 (0 + O, (9) Catalase is an enzyme that…
A: Enzymes are catalysts of biological systems that are used to accelerate the rate of a chemical…
Q: Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the…
A: Inheritance of eye colour It is autosomal trait and the inheritance is of Autosomal recessive. The…
Q: How does osmotic diarrhea differ from secretory diarrhea?
A: Diarrhea is a condition in which the frequency of stool increases along with increase in its…
Q: What level of protein structure is hexameric insulin?
A: The pancreas has a very important role in the body. It can function as endocrine as well as…
Q: The table below shows short DNA sequences from a gene in a closely related group of dragons, as well…
A: We have a group of seven closely related dragon species with homologous gene sequences. These are…
Q: What role do hydrogen bonds play in nucleic acid and protien syntheis
A: Although hydrogen bonds are weak covalent connections, they are crucial to the three-dimensional…
Q: How does vasodilation reduce the body temperature?
A: Body temperature is maintained by the center present in the form of the hypthalamus. Hypothalamus is…
Q: Match the description with the correct term. A. the idea that inherent variation in a population…
A: Evolutionary biology is the science of how evolution happens. Evolution is the mechanism of…
Q: Which of the following species is prokaryotic? A. Mus muculus B. Arabidopsis thaliana C.…
A: Prokaryotes - these are the organisms whose cells lack a nucleus and other organelles. Prokaryotes…
Q: The presence of a genetic material like the DNA is enough proof of life. True False
A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…
Q: Humans need food to provide energy. What other necessary component does food provide for the body? O…
A: INTRODUCTION The necessary components food provides to our body is briefly explained below.
Q: (6) a. When the humidity increases transpiration rate : a. Increases b. Decreases b. The reason for…
A: Transpiration is the loss of water in the form of vapour from the exposed parts of a plant. There…
Q: Which conditions would NOT lead to good preservation of a dead hominin skeleton? Group of answer…
A: Introduction A soil ecosystem is an example of a complex ecosystem as it contains a lot of living,…
Q: The key feature that distinguishes alternation of generations from other life cycles is O a distinct…
A: Introduction Alteration of generation is a life cycle of plants that involves two different phases…
Q: Can an epidemiologist who finds a correlation between the use of tanning beds and melanoma (an…
A: Introduction Epidemiology is a study that provides information about a health-related concern in a…
Q: (a) Explain the trend shown by the graph above. (b) Evaluate how effective an educational program or…
A: Diabetes mellitus refers to a group of diseases that affect how the body uses blood sugar (glucose).…
Q: If a variety of seaweed reproduces only through mitosis, this would be considered is "asexual…
A: Seaweeds reproduce in various ways. Lower types of Seaweeds reproduce asexually. Further developed…
Q: Maximum of 5 sentences: a. What limits a size of the cell and why? b. Describe the relationship of…
A: Introduction The fundamental building blocks of life are microscopic structures called cells. Even…
Q: Consider the steps involved in an experiment that uses the scientific method. Arrange the six given…
A: Scientific method is the systematic way of doing experimnet
Q: what happens to the field of view as magnification is increased useing shccdssively higher power…
A:
Q: Where are electrons, protons, and neutrons located inan atom?
A: Electrons, Proton, and neutrons are Atomic particles. Every atom contains an electron, Proton, and…
Q: Describe the settings in which the reversed process of proliferation and differentiation is…
A: Cell proliferation can be described as a process of exponential growth and division of cells for…
Q: Instruction: Go outside and observe your surroundings. From your observation, formulate a hypothesis…
A: INTRODUCTION Green plants and other certain autotrophic organisms synthesize their own food material…
Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…
A: Interbreeding It refers to the breeding of organisms with another organism of different species.…
Q: Draw a labelled diagram of a plant cell before and after insect attack in the case when pre-formed…
A: Plants are unique among eukaryotes, organisms with membrane-enclosed nuclei and organelles, in that…
Q: identity the slides with labelling and also mention the important features of this slides
A: Cryptococcus neoformans is a species of small encapsulated yeast that has the ability to cause mild,…
Q: Explain the following areas about (Types of laboratory devices) 1. Who makes up the device or what…
A: Device - Hot Air Oven Hot air oven is mainly used for following purposes . Dry sterilization…
Q: 3. Explain why the specimen must be centered in the field of view on low power before going to high…
A: Microscopy is the technical field of using microscopes to view objects and areas of objects that the…
Q: Why do electron microscopes have a better resolution versus light microscopes? OA. The additional…
A: Introduction: A method for getting high resolution photographs of both biological and non-biological…
Q: Bryophyte Seedless Vascular Plant Angiosperms [Choose ] Mid Largest Smallest [Choose ]
A: Introduction Gametophyte refers to the sexual stage of plants and some algae that involves the…
Q: name the three ways in which an ion channel can be gated.
A: Introduction:Protein-based structures make up the channels in a cell membrane, which open and close…
Step by step
Solved in 3 steps
- A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?After properly troubleshooting, you finally are able to visualize the gel. You obtained the image below. The ladder used is “Lambda Hind III”.Knowing that the ladder “Lambda Hind III” consists of six fragments (23130 bp, 9416 bp, 6557 bp, 4361 bp, 2322 bp, 2027 bp), properly label the bands in the gel image.In primer designing, which of the following statements is correct? a. Primers should be 18-24 bases in length. b. Base composition should be 45-55% (G+C). c. Melting temperatures between 55-70°C are preferred. d. All choices are correct.
- The concentration of a DNA sample is 40 nano grams per milliliter how many nanoliters will be needed to obtain 0.5 nano grams of DNAI have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step? show the exact process including the volume of water. Indicate if you would use p20,p200,p1000 for each reagant added. you can choose a total volume but cannot be less than 3 uL or exceed 1000uL. Thank you!!What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
- You have a 20 mg/ml of Ethidium bromide stock solution. You need to a final concentration of 2ug/ml into a Agarose solution to visualize DNA. What is the dilution factor? Give typing answer with explanation and conclusionImagine you are preparing to run a DNA sample which is approximately 600 base pairs long. What percentage of Agarose would you make your gel? Why?The SDS-PAGE gel matrix used to separate proteins by electrophoresis is composed of: A) Nitrocellulose B) Polyacrylamide C) Agarose
- In your forensic laboratory, you set up a reaction to digest DNA with restriction enzymes. The final volume will be 20 ?μl. How much of each of the following reagents will you use to obtain the indicated working concentrations? 10x restriction buffer >> working concentration 1x 1 mg/mL bovine serum albumin (BSA) >> working concentration 100?μg/mLHow much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one digit after the decimal point.In analyzing the base composition of a DNA sample, a student loses the information on pyrimidine content. The purine content is A = 27% and G = 23%. Using Chargaff’s rule, reconstruct the missing data and list the base composition of the DNA sample. (Include a brief explanation of how you got your results).