Q: What is copy-number variation? How does it arise?
A: It has been analysed that there is an unexpected variability in the individual human genomes. This…
Q: What is the genetic premises
A: A scientific premise can be defined as the knowledge that is gained based on the hypothesis and…
Q: What is an inactive gene?
A: A gene is a set of nucleotides that codes for a particular protein. Gene is functional unit of…
Q: What is a Nucleoid made of?
A: A nucleoid is found inside a prokaryotic cell. Prokaryotes are a microscopic unicellular organism…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: How are two topoisomers different from each other? How are theythe same?
A: The group of isomers that have the same molecular formula, stereochemical bond connections and…
Q: Is a gene a triplet ofconsecutive DNA nucleotides?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: each member of the gene pair come from?
A: Diploid organisms have a pair of genes
Q: What is an imprinted gene
A: Imprinted genes are genes that violate the usual rule of inheritance. Their expression is determined…
Q: What is a gene family? How are gene families produced over time?With regard to gene function, what…
A: Gene is known to be a hereditary unit. They are composed of DNA or deoxyribonucleic acid and some of…
Q: If circular B-DNA is positively supercoiled, will these supercoils be left- or right-handed?
A: Supercoiling of DNA is a biological process that regulated the unwinding and rewinding of the DNA…
Q: What are the function of single nucleotides polymorphism?
A: Single Nucleotide Polymorphisms(SNPs) is the single nucleotide which occurs at the specific position…
Q: What are long interspersed elements (LINEs) ?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Besides H1, how many different kinds of proteins are part of the nucleosome?
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: In a numeric pyramid,is it possible the base to be smaller than the other levels?
A: A pyramid of numbers or numeric pyramid shows the total number of individual organisms at each level…
Q: What makes the deletion of a gene?
A: Deletion is a type of mutation in which a part or sequence of a chromosome that can be a single base…
Q: What is terminal deletion in genetics?
A: A single break may cause terminal deletion; but, due to the need for specific chromosome tips…
Q: Why is the Nucleoid important?
A: The nucleoid is an irregularly shaped structure present in prokaryotic cells . It does not have any…
Q: What does the White gene code for?
A: Genes are the structural and functional units of heredity that carry coded genetic information in…
Q: what is structural gene and what is non-structural gene? what is the differences between them?
A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…
Q: What is a gene family?
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: The number of Chromosomes in the human gene is ___.
A: The chromosomes are thread-like structures that carry genetic information. They are made up of DNA…
Q: What is a gene? Provide at least two different definitons and explain.
A: DNA contains gene that has genetic information and passes to the next generation. The functional…
Q: Which are enzymes that shorten the poly-A tail ?
A: Cytoplasmic PABP2 is having some canonical functions. Along with this, it also induces poly(A)…
Q: What is the function of histones?
A: Chromosomes are thread-like structure situated inside the nucleus of plant and animal cells. Each…
Q: How many types of histones and non histone are there?
A: Histones are highly basic proteins present in the eukaryotic cell nuclei. They pack and order the…
Q: What is the function of histone?
A: The folding of the DNA molecule into a compact, orderly structure that fits into the limited space…
Q: centromeres consist which two sequences?
A: Centromere is the region in a chromosome that connects the sister chromatids together. Chromosome is…
Q: Why might the locations of introns and exons be the same in both alpha- and beta-hemoglobin genes?
A: Exons are conserved DNA and RNA nucleotide sequences that play a role in the production of mature…
Q: What are the penetrance and the expressivity of a gene?
A: In some cases, individuals who have the same genotype do not display the same phenotype in exactly…
Q: What mutagen results to the formation of thymine dimers?
A: Asked : Mutagen which results to the formation of thymine dimers
Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…
A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…
Q: What is a microdeletion?
A: Chromosomes are structures present in the nucleus of the cell. The chromosomes are formed of DNA…
Q: Is an ORF a gene?
A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…
Q: What is the physical structure of a gene?
A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome is…
Q: Besides the size and position of the centromere, what is the same about these?
A: *Chromosomes are thread like structures located inside nucleus which is made of protein and a…
Q: What are geneticmutations?
A: A gene is a sequence of nucleotides in genome that codes for a functioning molecule. There is…
Q: Why Some hypermorphic alleles encode overactiveproteins?
A: A mutation is any alteration in the sequence of DNA. It may be caused due to error in replication or…
Q: What mechanism generates a gene family?
A: Gene family is a set of many similar gene. An example of gene family in humans is the genes for…
Q: What are the histone types found in the octamer wrapped by DNA strands?
A: Introduction: The DNA is wrapped around the histone protein, and the structure formed is called a…
Q: What chemical component of the chromosome makes up genes ?
A: The cells have many organelles. Each organelle is involved in a specific function. The nucleus of…
Q: What is the function of the nucleoid in a bacterial cell?
A: The cell is the basic structural and functional unit of the body in all organisms. Cells are…
Q: What are genetic laws
A: Genes, genetic diversity, and heredity in living things are all studied in the branch of biology…
Q: How can a single gene encode multiple versions of a protein?
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: How many genes are there in a human cell .
A: Genetic material refers to the hereditary material found in the cells of all living things. It is…
Q: How much of the genetic coding of an organism is contributed by each parent?
A: Genetic code can be defined as the term that is utilized the way that the four bases of DNA--the A,…
Step by step
Solved in 2 steps
- What is a gene? How many oxons are in the basic structure of a geneWhat is the abbreviated name of the human gene that contains the following sequence CATCACGCCTGTCACCACCACCT? 1)APP 2)BCKDHA 3)MLH1 4)XRCC1 5)PMP22 6)ATR 7)MSH2 8)PSEN1 9)KMT2D 10)NF1What is a gene? Why are genes for rRNA and tRNA considered to be genes even though they do not produce polypeptides?
- In a study showing that approximately 10% of protein-coding genes are essential for Cell survival .This translates into which of the following number of essential genes in the human genome .a)100 b) 500 c)1000 d)2000One of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic material is compacted by wrapping the double-helix around histone proteins to form nucleosomes. 2. Eukaryotic genetic material consists of supercoiled circular DNA molecules complexed with proteins into chromosomes. 3. Eukaryotic genetic material consists of relaxed linear DNA molecules complexed with RNA into a 30 nm fiber. 4. Eukaryotic genetic material is compacted by folding linker regions around non-histone proteins to form a scaffold.a)histone H2A-H2B diner b) histone H3-H4 Octomer C) histone H1 D) histone h3-h4 tetramer
- If a prokaryotic gene coding region is 42 nucleotides long, beginning with a start codon and ending with a stop codon, how many amino acids will it have?The mass of a gene is 32,400 units. The amount of introns is twice the amount of exons. What is the mass of protein that encodes this gene, if the mass of the amino acid is 110 and the nucleotide is 300 units.Many aspects of gene function can be nicely explained with the one-gene-one-enzyme hypothesis, which states that a gene controls the production of an enzyme. Which of the following findings about gene expression, though, requires an expansion of this simple concept? Choose an answer below: Non-enzyme proteins are made from genes too. Some genes code for RNA molecules only. Enzymes composed of different polypeptides are coded for by more than one gene. a and c, but not b a, b, and c
- a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerThe region of a chromosome that encodes a single protein is called a _________, each of which can have more than one variation, these different variations are called _________.Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c) Allelt e ) Homozygous