Answered: If a parent cell has a haploid number…

Science

Biology

If a parent cell has a haploid number of 8, how many sister chromatids will be present after S phase is complete

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter11: How Cells Reproduce

Section: Chapter Questions

Problem 2SA: A duplicated chromosome has ______ chromatids. a. one c. three b. two d. four

See similar textbooks

Related questions

Q: Marisol has an Earth Overshoot Day of April 11th. Ali's Earth Overshoot Day is July 5th. Esperanza's…

A: Earth overshoot day is a day dedicated to one day of the year where the usage of natural resources…

Q: 2.Read and analyze the question and choices CAREFULLY; more importantly, ALWAYS CHOOSE the BEST…

A: Male reproductive System on flower consist s of: Stamen Anther- part of stamen that has pollen…

Q: How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the…

A: Kanamycin inactivation :-

Q: The “big portion of the brain” that the narrator highlights first is the

A: Answer :- As we know that big portion of the brain is called cerebrum. And , The cerebrum is the…

Q: "back of the brain" is the Notice the arbor vitae within it.

Q: 29. In the pedigree below, squares represent males and circles represent females. Individuals who…

A: Pedrigee analysis is the representation of presence of particular traits and how they are inherited…

Q: How do gases get in or out of the leaves?Read

A: When a plant is carrying out photosynthesis carbon dioxide needs to move from the air into the leaf.…

Q: What are the ways that you can do to help your body in maintaining your glucose level?

A: Glucose and diabetes

Q: Order the following extravasation-related events as they occur.…

A: The white blood cells are responsible for giving immunity to the body. Different types of WBCs are…

Q: It has been said that in terms of water balance, behavior cancompensate for physiology, or…

A: Introduction Osmotic balances are necessary to sustain life. Osmotic balance is due to the balance…

Q: Give the different classes of each phylum. 1. Phylum Cnidaria 2. Phylum Mollusca 3. Phylum…

A: Cnidaria Radial symmetry, tissue level of organisation, acoelomate animals. Classification: On the…

Q: Being as specific as possible, discuss how global warming can beexpected to alter the water…

A: The release of greenhouse gases in the air has caused an increase in the global temperature called…

Q: During phase I, venous return occurs and blood enters relaxed atria. The pressure in the veins is…

A: Aorta carries oxygenated blood to different parts of body and pulmonary arteries carry deoxygenated…

Q: The cardiac cycle includes all the events associated with the flow of blood through the heart during…

A: INTRODUCTION The cardiac cycle describes the human heart's activity from the start of one heartbeat…

Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…

A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…

Q: Nutrients (such as N, P. K) are important for the increase in net primary production which will be…

A: Different macro and micronutrients are responsible for inducing the growth and reproduction of the…

Q: As a genetic counselor, you inform Susan and John that a blood test for cystic fibrosis is…

A: Genetic counselor

Q: Explain the process of inspiration under normal conditions

A: Introduction Inspiration is the process of bringing air from outside the body into the lungs. it…

Q: Define oxygen dissociation curve. Can you suggest any reason for its sigmoidal pattern?

A: Oxyhaemoglobin saturation curves are graphs that show the percentage saturation of oxyhaemoglobin at…

Q: Humans are living longer, and that increases the risk of getting cancer during their lifetime.

Q: Define RQ. What is its value for fats?

A: RQ stands for respiratory quotient. It is the ratio of amount of carbon dioxide evolved to that of…

Q: (i) Why are both differentiation and self-renewal essential for the functioning of stem cells in the…

A: i) Stem cells are those cells which are responsible for the formation of different type of cells…

Q: Question 9. What basal transcription factors can only bind to the DNA within the pre-replication…

A: The basal transcription factor TBP binds to the TATA box, a DNA sequence found within many, but by…

Q: What does DNA polymerase need in order to make contact with a replication origin

A: The replication of DNA is the process that is mediated by several enzymes and additional proteins.

Q: How do vaccines help your immune system against the covid-19 virus?

A: Vaccines help our immune system against covid-19 virus.

Q: how does the location and abundance of regulatory DNA sequences change with increasing organism…

A: Promoters, enhancers, and silencers are the three main types of regulatory sequences.

Q: Which is true about non-vascular plants?Read

A: Nonvascular plants are called bryophytes. Nonvascular plants include liverworts, hornworts, and…

Q: 19. Independent assortment of chromosomes is a result of which of the following processes? A) the…

A: As per Bartleby Guidelines experts are allowed to answer only 3 sub parts kindly post the other…

Q: Discuss "The respiratory pathway is an amphibolic pathway."

A: Introduction In this question we will discuss about " the respiratory pathway is an an amphibolic…

Q: Discuss the advantages and disadvantages of targeted vs mass control using COVID-19. ( if you can…

A: Covid-19 is a viral infection caused by a coronavirus.

Q: What is the connective tissue at the junction between the stomach and the small intestine?

A: Tissues are the group of cells performing similar functions. Tissues are of 4 types one of them is…

Q: Suppose there were plants that had a high concentration of Chlorophyll-b, but lacked chlorophyll-a,…

A: Introduction In this question we will discuss why do plants have chlorophyll b and other accessory…

Q: importance of plasma proteins

A: Plasma proteins These are blood proteins or the proteins present in the bloodstream. They are of…

Q: Why does TTX reduce the response caused by nerve stimulation and also the response to direct muscle…

A: Tetrodotoxin (TTX) is a powerful poison that explicitly ties to voltage gated sodium channels. TTX…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: what race is (and what it is not) from a biological perspective.

A: Answer

Q: 3.Which hormone promotes ripening of fruits? Read and analyze the question and choices CAREFULLY;…

A: Ripening in fleshy fruits induces changes such as coloure development, softening, starch hydrolysis,…

Q: Why are food chains relatively short? O Not enough energy is transferred from one trophic level to…

A: Food chain can be defined as a transfer of food energy from producers(first trophic level)from one…

Q: Which are thought to have evolved first, aerobic bacteria or photosynthetic bacteria? Explain.

A: There are two main types of bacteria, aerobic and anaerobic. Aerobic bacteria need oxygen to…

Q: .Which refers to all tissues outside the vascular cambium?Read and analyze the question and choices…

A: Plant has two main transport system - xylem and phloem. The xylem helps in transporting of water…

Q: explain properly. How is a species’ population dynamics affected by the presence of another species…

A: A species ecological niche can be defined as the range of resources and the conditions allowing the…

Q: What would happen to the ATP yield of cellular respiration if: The inner membrane of the…

A: The cellular respiration involves breakdown of glucose and production of energy in the form of ATP.…

Q: 1. Biolistics: plant tissues; heat shock treatment: _______ a. mammalian cells b. viruses…

A: 1) Answer : Biolistics: plant tissues; heat shock treatment: ____bacteria___ Chemically prepared…

Q: Diffusion of gases occurs in the alveolar region only and not in the other parts of respiratory…

A: Each alveolus is composed of a thin layer of squamous epithelial cells that are highly permeable and…

Q: .Who among these evolutionary thinkers stated that the living forms come from the seas? a. Erasmus…

A: Introduction Evolution:- It is simply the biological change of a species over a span of time or the…

Q: You are in your kitchen looking out of the window watching a group of people 100 m in the distance.…

A: The retina is the photosensitive layer in eyes that contain rod and cone cells. If light exposed on…

Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…

A: Nuclear factor-κB (NF-κB), a transcription factor that is essential for inflammatory responses, is…

Q: Some species of animals gain physiological advantages byexploiting the specialized physiological…

A: Mammals are usually defined in the way that they are a group that includes humans—are warm-blooded…

Q: brown-eyed sheep is crossed with a homozygous green-eyed sheep, blue-eyed offspring are produced. If…

A: DISCLAIMER As per the guidelines, as you have asked multiple questions, we will solve the first…

Q: Which of the following interventions will increase cardiac stroke volume? increased activity of…

A: Stroke volume: The quantity of blood discharged from the ventricle during each cardiac cycle is…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

Please answer asap and type your answer and do not copy from anywhere please ?

If a parent cell has a haploid number of 8, how many sister chromatids will be present after S phase is complete
O a. 8
ОБ.16
О с. 32
O d. 64
O e. 128

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Consider a diploid cell from an unknown organism that undergoes meiosis. The four gametes produced have 8, 8, 7, and 5 chromosomes. When did nondisjunction occur? a. Only meiosis I b. Mitosis c. Meiosis I and II d. Nondisjunction did not occur e. Only meiosis II Clear my choice
How many daughter cells are produced in mitosis? A) 2 B) 4 C) 8 D) None
If a typical diploid somatic cell has 32 chromosomes, how many chromosomes are expected in each gamete of that organism? A. 32 B. 46. C. 64 D. 16 E. 0
Diploid cells have a. two chromosomes.b. two sets of chromosomesc. one set of chromosomes.d. two pairs of homologous chromosomes
At which stage of meiosis are sister chromatids separated from each other? a. prophase I b. prophase ll c. anaphase I d. anaphase ll
If a muscle cell of a typical organism has 32 chromosomes, how many chromosomes will be in a gamete of that same organism? a.8 b. 16 c. 32 d. 64
A diploid cell has _ ____ the number of chromosomes as a haploid cell. a. one-fourth b. one-half c. twice d. four times
A duplicated chromosome has ______ chromatids. a. one c. three b. two d. four
Chiasmata: a. form during metaphase II of meiosis. b. occur between two nonhomologous chromosomes. c. represent chromosomes independently assorting. d. are sites of DNA exchange between homologous chromatids. e. ensure the resulting cells are identical to the parent cell.
How many chromatids are visible in a human cell at the start of anaphase I? a. 23 c. 92 b. 46 d. 184
If a diploid organism has 14 chromosomes (2n=14) a. How many chromosomes will its gametes have? b. After meiosis I during gamete formation, how many chromosomes are in each daughter cell? c. After meiosis I during gamete formation, how many chromatids are in each daughter cell?
a. What type of cell division mitosis, meiosis I or meiosis II is shown in this figure? b. What is the diploid number of this organism? c. Provide labels for (i) and (ii)