In the diagram, if base 4 is adenine, what is base 11' ? at Aab.89'2.6.10331011'4"1"012A diagram of a DNA replication fork indicating 4 single strands of DNA with the bases numbered. The bases are numbered Ton the far left strand, top to bottom, and 8-14 on the far right strand top to bottom. The second strand from the left is labele1 to 6 from top to bottom. The second strand from the right is labeled 8 to 13 from top to bottom.12136'1314REPLICATION FORKIn the figure, if base 4 is adenine, what is base 11 (remember the complimentaryconfiguration of bases in DNA?59°F Cloudy GE#品四国9 Type here to search

Name: In the diagram, if base 4 is adenine, what is base 11' ? at Aab.89'2.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In the diagram, if base 4 is adenine, what is base 11' ? at Aab.89'2.6.10331011'4"1"012A diagram of a DNA replication fork indicating 4 single strands of DNA with the bases numbered. The bases are numbered Ton the far left strand, top to bottom, and

Answered: Image /qna-images/answer/284a8dca-2e2f-49fc-b69b-022a6b76e8e8.jpg

Answered: if base 4 is adenine, what is base 11'…

Science

Biology

if base 4 is adenine, what is base 11' ?

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 1ACQ: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired...

See similar textbooks

Similar questions

If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'- A A C G G T C C A G T C C A A G T T A C G-3'
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
Draw a 4-N base strand of DNA with all four N-base sequences represented
what is main difference for B-DNA，A-DNA and Z-DNA？（in biochemistry）
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
110.Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during the termination of replication in the lagging strand? A. DNA Ligase B.DNA Polymerase III C.RNA Primase D.DNA Topoisomerase
What enzyme breaks the H-bond between nucleotides of DNA? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase III
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Which of the following statements best describes why one of the daughter strands is synthesized in pieces? the enzymes that synthesize DNA are slower that the enzymes that unwind the double helix and this produces 'lagging time' the enzymes that synthesize DNA can only do so in a 5' --->3' direction this figure illustrates a eukaryotic cell since prokaryotic cells do not synthesize DNA…