If the gene for primase were mutated so that no functional primase was produced, what would be the effect on the two types of bacterial DNA replication? Theta replication Replication could occur only on the leading strand. Answer Bank Replication would be unable to initiate. Replication would occur, but without proofreading mechanisms. Replication would occur, but Okazaki fragments could not be connected on the lagging strand. Rolling circle replication Replication could proceed without a primase.

If the gene for primase were mutated so that no functional primase was produced, what would be the effect on the two types of bacterial DNA replication? Theta replication Replication could occur only on the leading strand. Answer Bank Replication would be unable to initiate. Replication would occur, but without proofreading mechanisms. Replication would occur, but Okazaki fragments could not be connected on the lagging strand. Rolling circle replication Replication could proceed without a primase.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

If the gene for primase were mutated so that no functional primase was produced, what would be the effect on theta replication? On rolling circle replication?
A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.
If the gene for primase were mutated so that no functional primase was produced, what would be the effect on theta replication? On rollingcircle replication?
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
Suppose that replication is initiated in a medium containing moderately radioactive tritiated thymine. After a few minutes of incubation, the bacteria are transferred to a medium containing highly radioactive tritiated thymidine. Sketch the autoradiographic pattern that would be seen for (a) undirectional replication and (b) bidirectional replication, each from a single origin.
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: ...TAGT... ...ATCA... 1. ...TACT... ...ATGA... 2. ...TAAT... ...ATTA... 3. ...TAAT... ...AT_A... 4. ...TA_T... ...ATAA... 5. ...TATT... ...ATAA...
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: a) ...TAGT... ...ATCA... b) ...TACT... ...ATGA... c)...TAAT... ...ATTA... d) ...TAAT... ...AT_A... . e) ...TA_T... ...ATAA... f)...TATT... ...ATAA...
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above