The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'

Q: Which of the following strands of DNA always has the same sequence (except T-> U) as its…

A: In genetics,a sense strand or coding strand is the segment within double stranded DNA which carries…

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: Which dna strand will be synthesized continuously during dna replication? a.The strand that is…

A:

Q: If a segment of DNA is 5'CATTAC—3', the complementary DNA strand is (a)3'—CATTAC—5'(b) 3'—GTAATG—5'…

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: Which of the following sequences would be complementary to a DNA strand with the sequence…

A: Complementarity refers to a relationship between two structures each following lock and key…

Q: A DNA strand has the following sequence:      5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…

A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: Which letter(s) represent the 3' end of the DNA molecule? You can choose more than one answer. B…

A: which letter represent the 3' end of the DNA molecule you can choose:

Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…

A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…

Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…

A: DNA  In DNA there are 4 bases  Adenine, Thymine, guanine and cytosine.  Adenine binds with Thymine…

Q: DNA replication is said to be semiconservative because a. one of the new molecules conserves both of…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…

A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…

Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…

A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'

Q: Which of the following is not a feature of eukaryotic DNA replication? a. Replication bubbles move…

A: DNA (deoxyribonucleic acid) is the genetic material of an organism. The specific nucleotide sequence…

Q: DNA replication is said to be semiconservative becausea. each new DNA molecule contains one new…

A: DNA replication is the process of generating  two same replicas of DNA from one original DNA.

Q: In the lagging strand, DNA is made in the direction _________ the replication fork and is made as…

A: The DNA replication is the process by which the genetic material of the organism copies itself to be…

Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…

A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…

Q: In the diagram of replication shown here, fill in the blanks with the appropriate terms: (a) base…

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: Which of the following is the correct way that a polynucleotide chain is put together in one DNA…

A: DNA is a polynucleotide. It is a polymer of nucleotides. The individual nucleotides are joined by…

Q: DNA replication occurs by adding (Note: NTPS = nucleotide triphosphates; dNTPs = deoxynucleotide…

A: Replication of DNA, the genetic code carrier molecule of the cell is an essential process in cell…

Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…

A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…

Q: Which model accurately represents the semi-conservative nature of DNA replication? Figure A Figure…

A: Semiconservative mode of DNA replication means half conserved DNA synthesis.

Q: The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5'…

A: In our body genetic information is stored in form of DNA. DNA can be converted to RNA by…

Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…

A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…

Q: Which of the following double stranded DNA molecules would require the most amount of energy to…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which of the following steps in DNA replication would occur second? 1.DNA molecule separates into…

A: Replication occurs in three major steps: the opening of the double helix and separation of the DNA…

Q: Which process in protein synthesis is most affected by a silent mutation? Select one: a. Replication…

A: Silent mutation are essentially base replacements that outcome in no difference in the amino acid or…

Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…

A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…

Q: E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…

A: Complementary DNA  is synthesized from a mature mRNA strand and it lacks both promoters and introns.…

Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…

A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…

Q: A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs,…

A: DNA is a double helix structure that is made up of two anti-parallel strands of a polynucleotide…

Q: Label all of the lettered components (A through H) in the figure of DNA replication below. C A G E

A: Replication is the process in which a double-stranded DNA molecule is copied. It is copied to…

Q: Which of the following statements is true about DNA? Select one: O a. The two strands of DNA are…

A: The DNA molecule is a polymer of nucleotides.  Each nucleotide is composed of a nitrogenous base, a…

Q: Below is a figure representing DNA replication. One end of the DNA is labeled; given this…

A: * DNA replication is a  process in which double stranded DNA molecule is copied and hence produce…

Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…

A: Correct order is 1.)- b. 2.)-a. 3.)-c

Q: Draw the steps of DNA replication. Use the following nucleotide sequence as reference:  5’ C C T A…

A: Introduction A double-stranded DNA molecule is replicated during replication to create two identical…

Q: Which of the following statements is/are TRUE for DNA Replication? Two daughter DNAs are formed,…

A: DNA replication is a process by which 2 copies of DNA are produced from a DNA double helix using…

Q: If the sequence of one strand of DNA is CTCGGA, the sequence of the complementary strand will be…

A: DNA has two strands that are antiparallel and complementary to each other. Antiparallel means that…

Q: S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and…

A: DNA is the genetic material of a cell that carries hereditary information required for the survival…

Q: Illustrate some steps involved in DNA replication :Suppose the following base sequence was found in…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 14

A: DNA replication is a process in which a single DNA molecule under goes replication and produces two…

Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…

A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…

Q: In DNA replication, which daughter strand is more likely to have a mutation? Select one: O a.…

A: DNA replication occurs differently in two different strand of DNA. The replication process in…

Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…