If you saw a red afterimage of flag stripes after staring a green-striped flag for a long-time, it is because color opponent cells were: Fatigued fo green, and so the red opponent dominates Fatigued for red, and so the green opponent dominates  Fatigued for yellow, and so the blue opponent dominates Fatigued for blue, so the yellow opponent dominates

Q: Which bulb shaped structures found at the end of neurons form connections with the dendrites and som...

A: Introduction :- A neuron is a nerve cell that serves as the foundation of the nervous system. In man...

Q: Match the numbers with the correct structure names 1 aorta tricuspid valve left ventricle

A: Heart: human heart has four chambers as follows- right atrium, right ventricle, left atrium, and lef...

Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...

A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...

Q: Q14

A: The sensitiveness of an organelle to a particular stimuli is based on the fact that how it reacts in...

Q: Why do we need to understand cell physiology in public health?

A: Public health is a science of preventing disease and improving the health qualities of communities v...

Q: vector pUST, gene W, and the restriction cut sites. What are 3 cutting strategies for cloning gene W...

A: *Cloning means producing an organisms with identical DNA either by natural or through artificially ....

Q: Unlike a rabbit, running all-out for a few moments to escape a predator, migratory birds require ene...

A: Acetyl coenzyme A is a key metabolic intermediate that is produced in a variety of methods, includin...

Q: 5. One student has got 300 g of carbohydrates and 50 g of proteins with dinner, another- 300 g of ca...

A: In general, most adults should target their diets to comprise of 45-65% Carbohydrates, 10-35% Protei...

Q: Why does evenly distributed peak in DNA chromatogram is an indication of a good sequence?

A:   Evenly spaced peaks indeed indicate a good DNA sequence. Generally, four colours of peaks are obta...

Q: Hypothesize  as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...

A: Answer Iron is an essential element for bacteria because an iron is participation in the tricarboxyl...

Q: outline the use, description, history, and functionality of a compound light microscope

A: Description of Compound Microscopes:-  A compound microscope is an upright microscope that uses two ...

Q: egarding the endocrine system, which of the following statements is FALSE? A. Hormone secreted durin...

A: Various physiological systems constitute the human body. There are a total of 12 organ systems in th...

Q: Please choose all the correct statements regarding early chordates. Amphioxus has all four defining ...

A: Amphioxus has all four defining chordate characteristics as an adult- This statement is Correct beca...

Q: Please discuss pathogenicity and the mechanisms by which microorganisms can attack the human body.

A: Any condition in which the body's normal structure or functioning is damaged or hindered is referred...

Q: there is a type of epithelial tissue called pseudostratified. Why?

A: The tissues associated with enveloping human body’s exposed surfaces can be described as the epithel...

Q: How might culture age affect the results of a spore stain? O If the bacterial culture is too young, ...

A: Bacteria are single-celled, tiny creatures that may enter healthy tissues and grow rapidly. The bact...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Why evenly spaced sequence in chromatogram is an indication of a good DNA chromatogram?

A: The characteristics of an evenly spaced sequence are:-  Evenly-spaced peak, each being monochromati...

Q: What would happen to the red blood cells of a patient who was treated with 10% saline?

A: Red blood cells are the most common erythrocytes or blood cells in the circulatory system. It helps ...

Q: Who would you expect to have the most frequent sex and the most satisfying sex, hook-up couples or c...

A: Reproduction ensures the continuity of species on earth. But it is not necessary for survival. Throu...

Q: mosses including their life cycle

A: Solution : Mosses are flowerless small plants found under the division Bryophyta along with liverwor...

Q: Platelets are capable of which of the following? Select all that apply.   activate clotting enzymes ...

A: Platelets:- Platelets are tiny blood cells that help your body form clots to stop bleeding. Activati...

Q: PHOW does the oxygen binding curve of fetal hemoglobin differ from that of adult hemoglobin

A: Oxygen binding curve for foetal haemoglobin is shifted towards left relative to the curve for adult ...

Q: 14. You are studying two strains of C. diptheriae and find that one strain is fully capable of causi...

A: Difference:-  The difference between two strains of Corynebacterium diptheria, one of which can caus...

Q: What should be the main consideration/s in grouping protozoans?

A: In the classification system, protozoa are considered a subkingdom of the kingdom of Protista, despi...

Q: Refer to the pedigree below which shows inheritance for achondroplasia (dwarfism), a dominantly inhe...

A: The Pedigree is not skipping  the generations and males and females are equally having affected with...

Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...

A: Heart: it is an organ that pump the blood across the body via vascular system.  Vascular system: it ...

Q: Under which scenario can a hawk successfully invade (or persist among) a population of doves?  Grou...

A: The evolutionarily stable strategy, often known as the Hawk-Dove Game hypothesis, is a famous exampl...

Q: occurring

A: The Department of agriculture regulates field testing of GM crops for research. The environmental pr...

Q: A 1-day old Caucasian male neonate was born to a 24-year old gravida 1 female at 37 weeks gestationa...

A: Until the age of six months, neonatal are not able to make their antibodies themselves.

Q: At the hydrothermal vent in the deep sea, the specific symbiotic relationship between the bacteria t...

A: A close ecological link between organisms of two or more species is known as symbiosis. Sometimes bo...

Q: Enter Full Screer 39. How would you describe the quaternary structures below? a. Aquaporin c. Aminop...

A: a. Aquaporin:- The aquaporins (AQPs) are a family of small membrane-spanning proteins having monomer...

Q: River otter Largemouth bass 10 10 20 30 40 Amblent (environmental) temperature ("C) Based on your un...

A: Any self-regulating process through which an animal maintains equilibrium while responding to condit...

Q: Mitochondria are located in the _ and serve as _ ? A. Cytoplasm; the energy producers of the cell B....

A: Mitochondria is one of the important organelle found inside all the eukaryotic cells. It is a double...

Q: Trivia about analogous structures

A: Analogous structures in evolutionary biology are biological structures with similar or corresponding...

Q: Is Thomas Hunt Morgan an interdisciplinary thinker?

A: Thomas Hunt Morgan Native -American Specialization -zoologist geneticist Famous experiment -dorsophi...

Q: Explain the relationship between turgor and osmotic pressure

A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...

Q: When the relative abundance of an organism is used to determine the overall health of an environment...

A: Bioindicators are organisms, such as lichens, birds, and bacteria, that are used to monitor the heal...

Q: What is the virulence factor of Mycobacterium tuberculosis

A: Virulence factors are specific molecules of pathogenic organisms that cause the invasion against the...

Q: DNA replication

A: Introduction:- DNA, also known as deoxyribonucleic acid, is a nucleic acid molecule. A 5-carbon deox...

Q: An adoptive parent may not disinherit an adopted child.

A: biological children -  the  child conceived rather than adopted by a specified parent, and therefore...

Q: f a patient was experiencing difficulty controlling their movement and displaying motor tremors and ...

A: The nervous system can be described as an organ system associated with the flow of information from ...

Q: explain  the scope of practice for EMTs in arizona.  Is the scope of practice dictated by the state ...

A: Scope of Emergency medical technician is good in Arizona.  Avg salary per hour for emt in arizone is...

Q: Suppose a genetically engineered fish escapes into the wild, what do you think would be the implicat...

A: If  genetically engineered fish will enter a world where wild salmon are already in a precarious sta...

Q: Compare the somatic and autonomic nervous systems

A: somatic nervous system  is  brain and spinal cord both  are responsible for processing or integratin...

Q: From 25 samples, each with size 10, you estimated that the hospital's EHR downtime average time was ...

A: An EHR, or Electronic Health Record, is a comprehensive system that allows a physician to keep track...

Q: From the options below, select the most likely effect of a mutation that causes cyclin B to be unabl...

A: Cell division is of two types: mitosis  meiosis

Q: 17. A 42-year-old man presents to the emergency department with a complaint of increasing shortness ...

A: Shortness of breath happens when your body's ability to breathe does not correspond to your brain's ...

Q: The same team of researchers sets up an additional cross with this same population. They cross two f...

A: Dominant allele always express themselves in heterozygous condition. 

Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH

A: Answer :-  1. Human weight :-  Phenotype is the noticeable physical or biochemical qualities of a in...

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.