If you wanted to protect 10 species how large a habitat would you need? In other words, how large a park (or protected area) do I need? Based on the picture

Q: A population consists of 300 individuals with the following genotypes: AA – 100…

A: Since p = 1 - q and q is known, it is possible to calculate p as well. Knowing p and q, it is a…

Q: In Figure 13-19C, the regulation of cholesterol synthesis by LDL in normal cells is compared with…

A:

Q: Phytonadione, also known as Vitamin K1, is required by the body for the modification of certain…

A:

Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…

A: Cellular respiration is the process by which energy is captured from food in three main stages. They…

Q: Which hormone and condition are mismatched? a. growth hormone-acromegaly b. thyroxine-goiter c.…

A: Hormones act as chemical messengers in our bodies. Proper functioning of the hormonal glands are…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: Homozygous wild-type male mice (AA BB CC) were crossed with triple mutant female mice (aa bb cc),…

A: If the geness are located on the same chromosome then they are called as linked genes. In this case…

Q: Most eukaryotic cells are below 10 microns. True O False

A: Humans, animals, fungi, plants, and protists all have eukaryotic cells. DNA is typically kept in the…

Q: Crossing over is an event occurring during metaphase II. True False

A: Crossing over is a cellular process that happens during meiosis a special type of cell division that…

Q: The following diagrams are longitudinal cross-sections of a sponge (Grantia sp.). Which diagram…

A:

Q: A client fell 2 days ago; he has a compound fracture of his left tibia. The physician performed an…

A: A damaged bone can be stabilised and healed using a procedure called open reduction and internal…

Q: 1. Are spores f 2. Are the gar 3. Are the arc 4. Is the domi (Circle answ 5. What are fid

A: Diploid sporophyte cells undergo meiosis to produce haploid spores. Each spore goes through mitotic…

Q: Below is a table that lists the labeled autosomal genes for this female karyotype. Select the…

A: The question is asking about the genotypes and phenotypes of the MCR-1 gene, LDLR gene, and ABO…

Q: An individual with an energy expenditure of 30 L of O2/mile and an RER of 0.2 would have to run how…

A: There is a non-linear courting among strolling pace and price of calorie burn. Essentially what this…

Q: For the below mating, what proportion of offspring will be blood type A? H/h; A/i* H/h; A/i A) 1/4…

A: Introduction  The classification of blood based on the presence or absence of antibodies and…

Q: Explain the events that would lead to uniparental diploidy in an organism

A: A mutation in genetics is an adjustment to the nucleic acid sequence of an organism's, virus's, or…

Q: Should aggression in humans be treated using medication? Explain why or why not

A: Aggressive behaviors can be managed well using non-pharmacological interventions. Medications should…

Q: Using figure (a) above as guide, list the five components in the CRISPR-Cas9 bacterial defense…

A: CRISPR is a acronym for Clustered regularly interspaced short palindromic repeats. It forms a very…

Q: (T/F) Balance and body position during flight would be monitored in part using hair plates located…

A: Question 1: True In bee hair plates are located in neck, at petiole and the junction where leg meet…

Q: In detail explain how photosystems I and II capture light using different photosystems

A: Photosystems, which are large complexes of proteins and pigments (light-absorbing molecules) that…

Q: Most of the time of the cell cycle is spent in prophase s-phase mitosis anaphase II none of the…

A: Introduction :- A cell's growth and division are accompanied by a sequence of processes known as a…

Q: what kind of chemicals might you add to try to speed up in the action of an enzyme or to inhibit its…

A: Enzymes are very crucial for chemical reactions as they act on the reactants/substrate in such a way…

Q: (A) BINDING 0.2 normal normal #A FH 50 100 0 bound (g/g cell protein) LDL LDL internal (µg/g cell…

A: Familial hypercholesterolemia is a genetic disorder occurring due to the aberration in chromosome…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Is the bacteria staphylococci harmful to humans?

A: Staphylococci can cause many forms of infection. (1) S aureus causes superficial skin lesions…

Q: AX pro pro BX met met X arg arg DX Hfr

A: Conjugation: It can be described as a transfer mechanism in which the two bacterial cells come in…

Q: Compare the mechanisms of LINE and SINE transposition

A: Non LTR retrotransposons dont contain long terminal repeats but they contain genes for reverse…

Q: The duplicated chromosomes are seen lined up in the center of the cell during prophase metaphase…

A: A sequence of various events take place when a cell starts to grown and divide, this series of…

Q: The term, "cell" was coined by Andreas Vesalius Robert Hooke Antonie van Leeuwenhoek Rudolf Virchow

A: Cell is the basic building block of all the living organisms. It is the structural and functional…

Q: Draw a picture of mitochondria. label the inner membrane, outer membrane, Inter membrane space and…

A: Mitochondria is the powerhouse of the cell. This organelle is involved in cellular respiration that…

Q: List three common components of microtubules and microfilaments.

A: Microtubules are arranged in the form of microtubule organizing centers. They are structures found…

Q: If the resting membrane potential of a cell was +70 mV, the ELECTRICAL driving force on sodium would…

A: A neuron's purpose is to turn the message received from the external environment into an electrical…

Q: 4) Many of the Platyhelminthes parasites we have investigated are advanced heteroxenous parasites…

A: Parasitic infection is an infection generated or spread by parasites. Some parasites do not cause…

Q: Compare and contrast cut & paste and replicative transposition.

A: Compare and contrast cut & paste and replicative transposition.

Q: Compare and contrast the reproductive strategies (for both fertilization and development) of fish,…

A: A process known as fertilization begins sexual reproduction when a sperm and an egg are combined.…

Q: Question 4: Does production of high density of leaf hairs affect the response to competition?…

A: A hypothesis in research study refers to a question or idea which needs to be tested experimentally…

Q: Question:- Which of the following statements about photosynthesis are FALSE?  a) Photosystem II…

A: Photosynthesis is the process by which chlorophyll containing organisms produce organic molecule…

Q: ►Diagram and label the relationship between metabolism, enzyme, activation energy, substrate and…

A: An enzyme is a substance that speeds up or controls the pace of reaction without changing itself.…

Q: enzyme that follows Michaelis-Menten kinetics has a KM value of 10.0 μM and a kcat value of 206 s−1…

A: This is about enzyme kinetics and the questions related to it Given values- Km = 0.0100 μM kcat =206…

Q: What enviroment factors would have contributed to there being bacteria on a door handle inside a…

A: Everyday door handles are one of the hotspots for bacteria, especially public handles. Because of…

Q: Would 1 change of xylene for 20 minutes be superior to 2 changes of xylene for 10 minutes each in…

A: Xylene is a volatile liquid hydrocarbon obtained by distilling wood, coal tar, or petroleum, used in…

Q: If an non disjunction occurs in meiosis 2 in a male and the resulting sperm fertilizes a normal…

A: Introduction  When a mother cell divides into two or more daughter cells, this process is known as…

Q: Which of the following statements correctly describes the function of the Sertoli cells? a.…

A:

Q: Given in the photo is a family that has a history of phenylketonuria (PKU). -Couple 1 Couple 2 DTO.…

A: Phenylketonuria (fen-ul-key-toe-NU-ree-uh), additionally referred to as PKU, is an extraordinary…

Q: why is it more advantageous for the cell to have its DNA fused to the cell wall as opposed to…

A: DNA is the nucleic acid present in majority of the organisms,ranging from prokaryotes to eukaryotes.

Q: 1. What is the nature of spore-bearing hyphae of the following: (tell whether it is enlarged tip,…

A: introduction : The long filamentous branching present in fungus and actinobacteria, known as hypha,…

Q: Items 6 to 11: What is the distance travelled by a DNA band with a MW of: 6. 4200 bp? A. 24.53 mm B.…

A: DNA or Deoxyribonucleic Acid is a polymer that acts as genetic material for 'at least' the majority…

Q: 1. Calculate how much energy (J) could be stored in young tendons by Maximal muscle contraction and…

A: It is known that 2% of the energy required and released for each stride of the muscle while we…

Q: In radish the effect of the alleles producing the red long variety is incompletely dominant over the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: What do you understand by “Sequencing by synthesis?” What is FRED score? Give an example.

A: DNA sequencing help in understanding basic structure of DNA which is nucleotide. Sequencing help us…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.