A A B IUD Av AsQuestion 31In DNA cloning, restriction enzymes are used to cutaDNA at specific sitesprotein at specific sitesCDNA at random sitesd.protein at random sitesQuestion 32(B)OH(C)ОНCH25'||c´HHCH25'|C1'HC1'4'H3'\H3'|2'HОНОНОНAed. (o Gartand Slence)The figures illustrate the structure of(B) ribose, (C) deoxyribose(B) thymine, (C) cytosine(B) deoxyribose, (C) ribose(B) cytosine, (C) thyminead.Question 33Choose the DNA nucleotide sequence that would be complementary to thefollowing strand (note: pay attention to DIRECTION of replication):5' GTAGTCA 3'Question 33 options:a3' UATUAGA 5'b5' TGACTAC 3'3' ACGACTG 5'd.5' UGACUAC3'.ns: On

“Since you have asked multiple question, we will solve the first question for you. If you want any…

Answered: In DNA cloning, restriction enzymes are…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained: Enzyme Fragment size (kb). EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 EcoRI+Hpall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 a. Is the original molecule linear or circular? b. Draw a map of restriction sites, showing distances between sites, that is consistent with the data presented. ques 2. You have double-stranded DNA that you radioactively label at the 5' ends. Digestion of this molecule with either EcoRI or BamHI yields the following fragments. The numbers are in kilobases (kb) and an asterisk Indicates the fragments that are unlabled EcoRI: 2.8, 4:6, 6.2*, 7.4, 8.0* BamHI: 6.0%, 10.0", 13.0 IF unlabeled DNA is digested with both enzymes simultaneously, the fragments 1.0, 2.0, 2.8, 3.6, 6.0, 6.2,7.4. What is the restriction map for the two enzymes?
The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence forthe enzyme BamHI—GGATCC—the four internal bases areidentical to the Sau3AI sequence. The single-stranded endsproduced by the two enzymes are identical. Suppose youhave a cloning vector that contains a BamHI recognitionsequence and you also have foreign DNA that was cut withSau3AI. Can this DNA be ligated into the BamHI site of the vector,and if so, why?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS

In DNA cloning, restriction enzymes are used to cut a DNA at specific sites b protein at specific sites DNA at random sites d. protein at random sites Question 32