In order for PCR (polymerase chain reaction) to be possible, we need to add reaction: O a DNA polymerase that can work at high temperature, e.g., 72C. O MRNA

Q: Explain how coenzymes connect the light-dependent reactionswith the Calvin–Benson cycle

A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...

Q: WHAT ARE THE CONCEPT AND IMPORTANCE OF THE FOLLOWING? I. Translocation through an artificial membran...

A: Osmosis is the spontaneous net movement or diffusion of solvent molecules through a selectively perm...

Q: If you were asked to build a model of a nucleotide, what structures would you need to represent in t...

A: Nucleotides are the building blocks of DNA as well as other nucleic acids like RNA. The basic elemen...

Q: 1. How easy was it to predict the possible composition of the 1st filial and 2nd filial generations ...

A: The question is in past tense, as if some type of mono,di or tri-hybrid cross was given as a part of...

Q: Explain why enzymes are considered "biological catalysts".

A: * All enzymes are proteins but all proteins are not enzymes. *An enzyme will increase the chemical r...

Q: 5. Make a molecular evidence cladogram. Cytochrome c is a protein located in the mitochondria of cel...

A: Answer :: Step :- 1   The given circular DNA data indicates that amoeba is closely related to ancest...

Q: What habitat is shared by micrognathozoans and gnathostomulids

A: They are both interstitial (living between sand grains). 

Q: Give an example of an animal in this food web at each of these trophic levels

A: In a food web, the primary producers are always the green plants and algae. Other animals cannot syn...

Q: coenzyme and cofactor

A: Coenzymes are small, non-protein organic molecules that carry chemical groups between enzymes . Cofa...

Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the...

A: Solution : correct option is C

Q: Which one of the following statements is not true?   Speciation is the process of creating new spec...

A: A species is a group of organisms that have genetic similarities, may interbreed, and are hence fert...

Q: ollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true o...

A: DNA polymerase is the enzyme used for the replication of DNA. The polymerase uses the template DNA f...

Q: Fork-lined method of the given alleles. A male having a characteristic of TtSsYy and a female TTSsYY...

A: Fork lined method is a method which is used to figure out which combination of genes or set of genes...

Q: Why are ethical constraints important in practicing medicine?

A: Ethical constraints It means to work under the accepted norms of society and to behave which is cons...

Q: A tree grows and increases its mass. Explain why thisis not a violation of the law of conservation o...

A: Atoms are the smallest things that are designed to be considered as the basic building blocks of the...

Q: List three general uses for industrial fermentation ethanol.

A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...

Q: RrYy X RrYy

A: RrYy X RrYy Parent 1= RrYy Parent 2= RrYy Gene 1 Alleles=Rr Gene 2 Alleles=Yy

Q: Spongy Bone

A: Red blood cells are formed in the red bone marrow of  the bones . stem cells are called hemocytoblas...

Q: What is true about Myoglobin

A: Myoglobin is protein which helps to supply oxygen to cells in our body.  It found in heart muscle an...

Q: Compare the cyclic and noncyclic light-dependent reactions

A: Introduction: As the anabolic reaction that transforms solar light energy into cellular chemical ene...

Q: Choose all that apply Which bones make up the shoulder/pectoral girdle? Group of answer choices Os C...

A: The shoulder or pectoral girdle is a set of bones that connects the upper limbs to the bones along t...

Q: You are studying a transport protein. It appears to bind temporarily to the molecule to be transport...

A: 1. ANSWER;- This is an example of facilitated diffusion. The molecule is a competitive inhibitor. -I...

Q: Amy is a new mother. Although she is very much against using disposable diapers, she is frustrated b...

A: Advantages and  of diapers For babies and toddlers this means they: Are comfortable to wear due to t...

Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?

A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...

Q: . A short homologous sequence called the macrohomologies which connects break ends of the strands. ...

A: Short Homologous sequence Is known as Microhomology sequence.  It involves asingment of microhomolog...

Q: A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effe...

A: D. Both A and B are incorrect. There is no change in the DNA sequence if nucleotides are added or re...

Q: Split DNA (old strand) Split DNA (old strand) T New DNA New DNA strand strand A T A А A C C G A T A ...

A: There are five nucleic bases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), th...

Q: Why is it surprising that humans consumed milk products long before the existence of the gene mutati...

A: * milk products mainly consists of sugar Lactose which will be digested by the enzyme Lactase  * Lon...

Q: Summarize the functions of membrane proteins.

A: A membrane is a one of the type of barrier which is selective in natures means it allows only some t...

Q: genetically engineered foods

A: They improve farm profitability and make farmers job 's easier. They allow farmers to greatly increa...

Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...

A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...

Q: Is COVID-19 virus will destroy/damage ALL the blood vessels and layers of the walls of the heart? if...

A: Even though COVID-19, the coronavirus that triggered the global pandemic, is largely a breathing or ...

Q: Bombay effect.

A: Bombay effect The Bombay blood group, is a rare blood type. This blood phenotype was first discovere...

Q: Explain why we say that photosynthesis feeds most life on Earth.

A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...

A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...

Q: Humans are heterodonts, which means they Group of answer choices have different types of teeth multi...

A: Human beings are highly evolved organisms that have a better thinking capacity. Humans share more co...

Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...

A: Introduction  Gene Regulation: The expression of genes is highly regulated in both prokaryotes as we...

Q: What is the experiment that helped Hershey and Chase recognize DNA as a genetic material? Explain in...

A: Introduction: The undeniable proof that DNA is the genetic material reached from the experiments of ...

Q: You are testing the effect of a particular fertilizer on a plant's growth. Your control plants don't...

A: Hypothesis It's an assumption, that's put up for the purpose of argument and then examined to determ...

Q: 1. You need to lower an injured friend from a building. His injury is located on his chest. Which of...

A: All the given question are provided us as a situation and we have to choose the right method accordi...

Q: 2. During the course of the growth of the soybean, you measured the volumetrie water content of the ...

A: The total volume of water applied during an irrigation event in megalitres (ML) is: the inflow rate ...

Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A re...

A: Bombay phenotype is extremely rare in ABO blood group with an occurrence of 1 in 250000. It is an au...

Q: ) Hydrogen bonds are critical to life because they Group of answer choices Are involved in the seco...

A: Hydrogen bonding is attraction between hydrogen atom to more electro negative atom.

Q: Differences between human male and female chromosomes.

A: Chromosomes is thread like structure in shape which is present in the nucleus and contain DNA  Genes...

Q: O 19% O Cannot determine O 62% O 38% O 31% OoooO

A: According to the chargaff's rule, we know that the purine bases and pyridine bases are present in ra...

Q: Provide a proof that a different phenotype can be produced from the same genotype. What are the poss...

A: A phenotype is a set of observable characteristics about a person, such as height, eye colour, and b...

Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a. Fix...

A: Coding sequence codes for functional protein products. Coding sequence codes for the functional prot...

Q: How can one use a pedigree chart to hypothesize how a certain condition is transmitted?  Can a pedig...

A: An individual's genotype determines his or her phenotype. The genotype is established by the alleles...

Q: Swimming just like any other exercise is accompanied by some risks of accidents. Therefore, it shoul...

A: Swimming ie considered as one of the main physical activities for making someone fit, both mentally ...

Crime Scene Investigation

A crime scene refers to a place where a crime has occurred. The purpose of crime scene investigation (CSI) is to analyze the complete scene and catch the culprit based on the pieces of evidence collected from the place of crime. The people involved in this process are referred to as crime scene investigators.