In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds. Now, however, they are reporting the presence and spread of superweeds which are resistant to the said herbicide. Give a brief explanation of this situation using what you learned about natural selection. (Modified from Hoefnagels, 2016)
Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…
A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…
Q: association of 2alpha and 2 beta chains to form adult hemoglobin identify which describes the…
A: Translation is process of conversion of RNA to protein.
Q: Target cells are: O Cells that send the signal O Cells that receive and respond to the signal Cells…
A: Introduction cell signaling or cell communication is the ability of a cell to receive, process, and…
Q: 25. What would be the effect of severing the corpus callosum?
A: Introduction :- The corpus callosum is a large bundle of more than 200 million myelinated nerve…
Q: Describe the two groups of invertebrate chordates, and draw atree showing how they relate to one…
A: Chordates contains two classes of invertebrates and one class of vertebrate. Invertebrates include…
Q: Function of lysosomes
A: Lysosomes are tiny bodies with a single membrane covering them. It contains a variety of hydrolytic…
Q: Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains…
A: Since you've asked multiple questions, we are only answering the first three answers for you. If you…
Q: What are the mechanisms by which viruses enter animal cells?
A: Introduction :- A virus is an infectious microbe made up of a nucleic acid segment (DNA or RNA)…
Q: Enzyme B requires Zn2+ (Zinc ion) to be functional. Zn2+ is a Cofactor O Product O Coenzyme O…
A: Coenzymes are chemical molecules that are needed for enzymatic performance by numerous enzymes.…
Q: The inhibition that make permanent damage to an enzyme is called: O Noncompetitive O Competitive O…
A: The enzymes are biocatalysts. These work as biochemical catalysts and catalyze different reactions…
Q: O Isotonic solutions. Pepsin enzyme becomes denatura Owhen pH is acidic O Temperature is very high O…
A: Temperature is very High.
Q: 3. One indication of the relative importance of various ATP-producing pathways is the Vmax of…
A: I gave you the answers below.
Q: Briefly discuss any two characteristics of microorganisms that should be considered when assessing…
A: Microbiology is the study of microorganisms and associated ideas. Microbiology has gone a long way…
Q: Actin can be used as a loading control in a western blotting experiment. What is the purpose of a…
A: A western blot is a scientific technique for detecting individual protein molecules in a protein…
Q: The concept of endosymbiosis as applied to chloroplast and mitochondria found in eukaryotes: a) is…
A: Endosymbiosis is a kind of relationship in which one organism enters in an another organism. The…
Q: Describe the traits common to all fishes.
A: Fishes are diverse. They have evolved to live successfully in underwater environment, from streams…
Q: Which of the following is not a sustainable fishing solution? O Limit the number of fish that can be…
A: Sustainable fishing is very important to continue fishing. Because it is essential to leave some…
Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…
A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…
Q: . heterochromatic regions decondense for gene expression a. pre-transcriptional control b.…
A: Heterochromatin regions are condensed regions of the chromatin that are transcriptionally switched…
Q: If you inhibit the closing of sodium channels what do you predict the effect on neuronal function…
A: Action potential in neuron is the direct consequence of voltage gated sodium channel. During the…
Q: Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains…
A: Since you have not specified which question you want the answer for, we are solving question 4 for…
Q: determine if the species is regular/irregular Regular/Irregular Hydrangea macrophylla…
A: Introduction Regular flower:- When the floral parts of each whorl of a flower are similar in size…
Q: During 24 months, a population of 5,000 prairie dogs experienced 6 500 births and 5 560 deaths.…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Most of the carbon dioxide we exhale is produced in: A) glycolysis. B) photosynthesis in the…
A: Aerobic respiration is an enzymatically controlled release of energy in a stepwise catabolic process…
Q: You are a legislator in a nation with no endangered species act. You want to introduce a law to…
A: Extinction is the extinction of a species or group of taxa. The death of the last member of a…
Q: Before a competition, a meal should be consumed that is high in... Water O Lipids O Carbohydrates O…
A: The purpose of the pre-competition meal is to calm an athlete's stomach by absorbing some of the…
Q: 17 Refer to the table. Reaction Chemical equation (kcal/mol) 2 glucose → maltose + H₂O +4.0…
A: The chemical reactions take place with the change of energy. The spontaneous reactions release…
Q: Which of the following statements BEST explains the relationship between the parts of genetic…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Select all that apply to root-associated fungi a. arbuscular mycorrhizal fungi cross the plant…
A: Soil is a thin layer of matter that forms on the earth's surface as a result of the processes such…
Q: Most enzymes are: O Nucleotides Proteins O O O O Lipids O Carbohydrates
A: As we know that an enzyme is a biocatalyst that increases the rate of chemical reaction .All the…
Q: Controlling for body size, would you expect a flightlessbird to produce eggs that are larger than,…
A: Flightless birds are birds that are unable to fly. These animals, which evolved from flying…
Q: Describe the mode of entry and method of reproduction of each representative trematodes…
A: * Schistosoma japonicum male worms are yellow in colour which measures about 12mm by 0.5mm with…
Q: 1.Which mechanism of evolution (selection, drift, mutation, non-random mating, or gene flow) do you…
A: Evolution is the process by which one species changes over time/generations in terms of various…
Q: You have a mouse model that is a homozygous knockout mutant for the prnp gene (Prnp protein is not…
A: knockout mouse is a genetically engineered laboratory mouse (Mus musculus) in which a specific gene…
Q: Neutrophil is a common White blood cell present in blood and the percentage of presence is: O 15% O…
A: Neutrophils are the most numerous white blood cells and it is an important part of our immune system…
Q: Figure 1 Figure 2
A: DNA is known as the deoxyribonucleic acid. DNA has the chromosome which carries the genes and these…
Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
A: RNA- It stand for the ribonucleic acid. is a nucleic acid present in all living cells and in some…
Q: Which of the following is a contrast in genetics organization between COVID19’s RNA & human DNA a)…
A: DNA and RNA are the two primary categories of nucleic acids. Nucleotides, which have a five-carbon…
Q: Why are mRNA vaccines more effective than conventional vaccines?
A: Introduction :- A vaccine is a preparation that stimulates the body's immunological response to…
Q: А D
A: Bones joins to form skeleton of body. Bones made from osteocytes cells, calcium & phosphates.
Q: Vhat are limiting factors for steady-rate aer elect 3 correct answer(s) Fluid loss Adequate reserves…
A: The aerobic respiration means the oxidation of the food in the presence of the oxygen. The…
Q: Activity C: Genetic Mutations: A mutation is a change in the normal DNA sequence of a gene. There…
A: DNA is the genetic material present in most organisms and genes form the basic functional unit of…
Q: Which of the following describes a strategy that can reduce land, water, and energy use in meat and…
A: For reaching the correct answer let's analyse all of the options given. Option 1-feeding livestock…
Q: IP3 binds to---- and DAG binds to O Calcium channel of SER/Protein Kinase C O Nucleus/Plasma…
A: IP3 stands for Inositol Triphosphate. DAG stands for Diacylglycerol.
Q: Normal vision father X normal vision ( carrier) mother
A:
Q: A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once…
A: Cell has many enzymes which help the cellular activities while other enzymes negatively regulate…
Q: In fruit flies, the allele for long wings (L) is dominant to the allele for short wings (l). If a…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Plant anatomy
A: The embryo develops at the micropylar end of the embryo sac where the zygote is situated. Most…
Q: Examine the two pedigrees shown in Figure Q7–3.One results from deletion of a maternally imprinted…
A: Genomic imprinting is defined as an epigenetic phenomenon where only one copy of a gene in an…
Q: how many different proteins composed of 100 amino acids could possibly exits?'
A: A protein molecule is made up of a monomer which is known as amino acid. So we can say the amino…
Step by step
Solved in 2 steps
- 1. Artificial Selection• Explain how artificial selection is like natural selection.• Why are quail useful subjects for an experiment on selection? What other organisms share similar characteristics?1.A) Adaptations to a Changing Environment• Explain why it is necessary for organisms to have the ability to adapt.• Why is the current environment making it difficult for organisms to adapt?• Explain how organisms develop adaptations.2. B) Artificial Selection• Explain how artificial selection is like natural selection.• Why are quail useful subjects for an experiment on selection? What other organisms share similar characteristics?One of the original Amish colonies rose from a ship of colonists that came from Europe. The ship s captain, who had polydactyly, a rare dominant trait, was one of the original colonists. Today, we see a much higher frequency of polydactyly in the Amish population. This is an example of: natural selection genetic drift founder effect b and c
- 1. Which among the following is NOT a principle of natural selection? a. The DNA sequence of the organism will change. b. The characteristics of organisms are inherited or passed from parent to offspring. c. Offspring vary among each other about their characteristics, and those variations are inherited. d. More offspring are produced than can survive. 2. Tawilis is a freshwater sardine endemic only in the Taal Lake in Batangas province. After several eruptions of the Taal volcano in the 21st century, the sardine population mentioned above rapidly dropped up to 82%. What best describe this scenario? a. mutation b. migration c. natural selection d. genetic drift7. In the course of human evolution, we can see in the fossil record a tendency towards increasingly large brains as this feature likely served as an adaptive advantage. In terms of natural selection this is known as a. Random Selection b. Stabalizing Selection c. Directional Selection d. Disruptive SelectionIn the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds. Now, however, they are reporting the presence and spread of superweeds which are resistant to the said herbicide. Give a brief explanation of this using what you learned about natural selection (Modified from Hoefnagels,2016)
- 17. Which of the following statements best explains the Theory of Natural Selection? * a. Organs that are not used may disappear, while organs that are constantly used may develop b. In nature, the organism with desirable characteristics may survive, while those weaker traits may not c. Organisms develop desirable structures to survive in a given environment d. Acquired characteristics of parents can be passed on to offspring 18. Larry Daley is a paleontologist found out some Central American Acacia species that have hollow thorns and pores at the bases of their leaves that secrete nectar. He used the species to understand the history and origin of the place. From the given situation, the Central American Acacia species is an example of _____________. * a. evolution b. fossil c. mutation d. coevolution1a-Farmers often use pesticides to kill insects to protect their crops. However, insect populations will often develop resistance to any pesticides that are used on them within a few generations. What is the selective pressure in such a scenario? O a. Pesticide treatment O b. The crops Oc. Pesticide resistance Od. The insects Oe. Mutation 1b-What is/are the element(s) required for a population to change due to natural selection? Select all options that are correct below. a. Variability in a population b. Genetic drift c. Inheritance of traits d. Differential survival e. Evolution4. Why is the Hardy Weinberg law of equilibrium important to a study of evolutionary processes? a. it tells us how heavy are mammals and if they may have lived in cold enviroments in the past. b. It shows us to measure change in gene frequency in population to see if selection pressures are affecting gene expression. c.It allows us to study how eplgenetics affects specific traits d. It allow us to measure the age of fossils and date the origin of a species
- Choose an organism that is a product of artificial selection. Give a brief description of your organism and its desired traits. What wild ancestor did it come from? Was it produced with selective breeding or genetic engineering (i.e. genetically modified)? What are the benefits of artificial selection in this case? Are there potential negative consequences?2) A species is a group of individual organisms that interbreed and produce fertile, viable offspring. According to this definition, one species is distinguished from another when, in nature, it is not possible for matings between individuals from each species to produce fertile offspring. Evolution is an important mechanism in the formation of new species. The evolution of a new species requires several components including all, BUT A) Evolution of a new species requires a long time. B) Evolution of a new species requires the need for a genetic change. C) Evolution of a new species requires a separation that prevents interbreeding. D) Evolution of a new species requires mutations that produce new genetic traits. Not Graded2) A species is a group of individual organisms that interbreed and produce fertile, viable offspring. According to this definition, one species is distinguished from another when, in nature, it is not possible for matings between individuals from each species to produce fertile offspring. Evolution is an important mechanism in the formation of new species. The evolution of a new species requires several components including all, BUT A) Evolution of a new species requires a long time. B) Evolution of a new species requires the need for a genetic change. C) Evolution of a new species requires a separation that prevents interbreeding. D) Evolution of a new species requires mutations that produce new genetic traits.