Q: What is the main idea of pseudoreplication in a manipulative experiment? Give an example problem of ...
A: Pseudoreplication is described as using inferential statistics to check for treatment effects with s...
Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past...
A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on hu...
Q: What are organelles, which carry out autophagy?
A: Introductioim this question we will write about the organelles, which carry out the autophagy .
Q: Question 9: Explain how a nucleosome is organized.
A: * Nucleosome is a portion of DNA wrapped around a core of proteins. *Inside nucleus DNA forms a comp...
Q: Consider Lamarck’s idea in a hypothetical situation. For example, you decided that when you have chi...
A: Lamarck gave a theory of use and disuse of organs suggesting that those organs will increase in siz...
Q: Write the definition of the following terms: 1. Life history traits 2. Trade-off
A: Life history Traits are heritable to some extent and are subjected to natural selection. This includ...
Q: 20. Normal gene order on a fruit fly chromosome is a b c d (cen) e f g. You have recovered a mutant ...
A: Introduction :- When a section of one chromosome, or a packet of genetic material, is flipped, the o...
Q: A contractile vacuole_____ . a. captures prey c. expels water b. stores food d. detects light
A: Introduction Contractile vacuole is a regulating organelle found in freshwater protozoa and lower me...
Q: Name two (2) main producers of Ginger and two (2) main importers of Ginger
A:
Q: What are the balanced chemical equations of breathing?
A: Introduction: Breathing is the process of inhaling air into the lungs and then exhaling it out of th...
Q: 1 2 3 4 5 7 TAC ATG GAC AAT GAT TAG GGG Second Letter A G Phe UCU UUU U UuC UUA UAU Ser UAC UAA UAG ...
A: Introduction : A gene mutation is a permanent alteration in the DNA sequence that makes up a gene, s...
Q: . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from ...
A: Mutation It can occur due to errors in DNA copying during cell division, ionising radiation exposur...
Q: Which type of information about the nucleotide sequenceof the target DNA is required ?
A: Targeted sequencing is defined as a process in which there is a rapid as well as cost-effe...
Q: Discuss the types of patterns in the organ system.
A: Our body contain different systems that perform different and specialised functions. All of the syst...
Q: expressing dominant mutant trait, caused by the "A*" allele %3D expressing recessive mutant trait, c...
A: Dominant traits are expressed in both situations ie in homozygous or heterogegous condition Recessi...
Q: 1.What observable structure makes these microorganisms ubiquitous or widespread in Rhizopus oligospo...
A: Rhizopus oligosporus is a fungus which is used for production of tempeh .And it is ubiquitous in nat...
Q: Why would the requirement for multiple hits make cancer less likely in younger people?
A: Cancer is a term used to describe diseases that involve abnormal cell growth. Cancer can occur anywh...
Q: Muro-ami is a fishing method where the fishes are driven out of a coral reef by pounding the corals ...
A: Introduction: The breeding, rearing, and transplantation of fish by artificial means is called pisci...
Q: i need the answer quickly
A: Marchantia is a genus of liverworts belonging to the Marchantiaceae family and the Marchantiales ord...
Q: Sample of Quality Policy of an organization
A: A quality policy is a brief statement that aligns with the organization's purpose and strategic dire...
Q: How do you explain evolution to people who believe that it is just a theory
A: Evolution is characterized as the course of development and improvement or the theory that organic l...
Q: Arrange the following cell ultrastructures in the order by which they will pellet out from a series ...
A: If we consider that the centrifugation is first carried out at lower speed and then the speed is ram...
Q: Brown thrashers are common birds that inhabit much of the United States. They use twigs, dry leaves,...
A: Reproductive fitness is defined as an ability of the individual to reproduce , survive and produce v...
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus t...
Q: What are the roles of ATP and NADPH in photosynthesis? a. ATP and NADPH are forms of chemical e...
A: On the Earth , the only source of energy is the Sun. Sun is the only source that provides energy to ...
Q: List the four cellular agents of bacterium that most antimicrobial agents such as antibiotics target...
A: Antibiotics are the secondary metabolites that are secreted by a group of microbes that declines the...
Q: 4. Cross a Male with hemophilia with a normal heterozygous female. What is the percentage of the gen...
A: A Punnett Square is a useful instrument that assists with the varieties and probabilities that can e...
Q: You are a mad scientist tasked with the evil job of designing a novel species. This species will be ...
A: The characteristics of this species can be as follows: - Infective in nature, involving either gast...
Q: Describe the various types of placentations found in flowering plants.
A: Placentation is the term used to describe the placement of ovules within the ovary. Placentation can...
Q: What is the relationship of Natural Selection and Speciation? Answer in no less than 10 sentences
A: Natural selection is a process in which an individual with enhanced reproductive fitness is selected...
Q: Cork cambium forms tissues that form the cork. Do you agree with this statement? Explain.
A: Introduction In this question we will discuss on the statement "Cork cambium forms tissues that for...
Q: It is that change is the of the und threat from the of trees as a of change? A Desert B Tropical Rai...
A: There are five major types of biomes. These are - aquatic, grassland, forest, desert, tundra. *Only ...
Q: How Web site, Webcutter are used for generating restriction maps ?
A: Constructing some long-range restriction maps are dependent on making the use of restriction enzymes...
Q: The Red Queen hypothesis is popular in ecology because it explains well the interaction between two...
A: Definition:- The Red Queen Hypothesis is a concept in evolutionary biology in which the species must...
Q: What is Hybridization/Annealing ?
A: Annealing which is also known as Hybridization is defined as the spontaneous pairing occur of comple...
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOC...
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the ...
Q: What does vacuoles do?
A: Vacuoles are membrane bound structure present in cell. Membrane surrounding vacuole is called tonopl...
Q: Q1: Why are E.coli cells subjected to heat shock induction when the optical density of the bacterial...
A: 1. The heat shock response is induced as a consequence of a rapid increase in sigma32 levels and sti...
Q: Question 2 of 10 Question 2. If an embryo that contains neural crest cells that are migrating from t...
A: Neural crest cell migration is required for the proper development of the body of a fetus. It is con...
Q: What is the conceptual connection between Figures 12-12 and 12-19?
A: 12-12: Regulatory sequences are revealed by chromatin remodelling (When SWI-SNF is attracted to a sp...
Q: According to the multi-hit model, more than one mutation must occur in a cell for cancer to develop....
A: A new multihit model of carcinogenesis is produced for use in assessing age-explicit disease rate ra...
Q: Diplomonads and parabasalids lack______ . a. a nucleus c. a plasma membrane b. mitochondria d. flage...
A: Diplomonads and parabasalids are members of the metamonad protist group, which lacks typical mitocho...
Q: Question 20. Explain briefly the alternation of generation in bryophytes.
A: The alternation of generations is represented by moss plants, which are gametophytes. In the gametop...
Q: How did population growth curve with LOW migration compare with the normal population growth curve? ...
A: Migration is movement of organism from one place to another.
Q: В A,
A: Laminaria is a genus of brown seaweed belongs to the order Laminariales.
Q: A mutation in a coding region of DNA, but that does not change the amino acid, would almost certainl...
A: *! silent mutation is due to a point mutation that gives different codon transcribed as a synonymous...
Q: Sporangium surrounded by archegoniophore 3 2 1 Sp
A: Answer
Q: What are organelles, which carry out autophagy?
A: Autiphagy is a degradative process that occurs inside the Eukaryotic cell in which the unnecessary c...
Q: Describe the method of preparation of planting material for Ginger and describe how it can be propag...
A: Introduction Ginger (Zingiber officinale) is a plant native to Asia, it is a flowering plant whose r...
Q: The purpose of the experiment is to study how_______(IV) affects the ______(DV). Explain the backgro...
A: Since two different questions are asked , we will answer the first question for you according to the...
In one, simple sentence define the function of the following
1. Helicase =
2. Alpha subunit of DNA polymerase III =
Step by step
Solved in 2 steps
- The function of the 5’-> 3’ exonuclease activity is found in which of the following: Group of answer choices 1 All of the above 2 DNA Polymerase II 3 DNA Polymerase III 4 DNA Polymerase I1.1 What components must be available for DNA polymerase III to proceed with DNA synthesis during replication? 1.2 What will the consequences for the cell be if the following enzymes are not functioning? DNA polymerase III Primase DNA ligaseDuring high stress environments, it has been found that some bacteria activate a genetic mechanism that allows them to incorporate more mutations into the DNA during replication. Would the following two enzymes be impacted by such a mechanism? (i)DNA polymerase IIIii) Helicase
- Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of the top and bottom strands.non-coding DNAs can be put into two groups, name themWhich enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase III
- A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityList the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
- Aflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect crops such as peanuts. Aflatoxin is a large, bulky molecule that chemically bonds to the base guanine (G) to form the aflatoxin-guanine adduct that is pictured below. In the figure below, the aflatoxin is orange, and the guanine base is purple. This adduct distorts the DNA double helix and blocks replication. a. What type(s) of DNA repair system is (are) most likely to be involved in repairing the damage caused by exposure of DNA to aflatoxin B1? b, Recent evidence suggests that the adduct of guanine and aflatoxin B1 can attack the bond that connects it to deoxyribose; this liberates the adducted base, forming an apurinic site. How does this new information change your answer to part (a)?Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging strand of DNA replication and name the major proteins required to carry out each of these steps in E. coli The first function is given. I. Function: Create RNA primer Enzyme: II. Function: Enzyme: III. Function: Enzyme: IV. Function: EnzymeThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side