Is it proper to list genus in this way in the example sentence below? The potential identity of the unknown bacteria could belong to genus Proteus, genus Providencia, or genus Serratia. Does the word genus need to be capatilzed? Do you need to say the word genus before it?.

Q: Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as…

A: A potential energy surface (PES) describes the potential energy of a system, especially a collection…

Q: What is meant by double circulation? What is its significance?

A: Double circulation is a process in which blood circulates twice through the heart in the course of a…

Q: What are the implications if your drinking water is contaminated with coliforms? And give three…

A: Public water systems are required to deliver safe and dependable consuming water to their clients 24…

Q: Define oxygen dissociation curve. Can you suggest any reason for its sigmoidal pattern?

A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…

Q: In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the…

A: Restriction enzymes These are also known as molecular scissors. These are enzymes that have been…

Q: Related species of terrestrial animals typically display allometricrelations between body-water…

A: In the system of the well-known term which is used to define the broadest sense, allometry describes…

Q: Give the different classes of each phylum. Phylum Echinodermata,Phylum Arthropoda and Phylum…

A: Animal kingdom consists of multicellular, eukaryotic animals. These are animals are divided into…

Q: What interval of time does the Anthropocenerefer to?

A: The major events during the evolution and origin of life on the earth are divided into three eras.

Q: Your next-door neighbor has donated $100 in support of cancer research and is horrified to learn…

A: Yeasts are eukaryotic, single-celled microorganisms delegated individuals from the parasite kingdom.…

Q: The brain stem also includes the bulb-like

A: The swollen part of the central nervous system located in brainbox having cavities filled with…

Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…

A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…

Q: T cells and B cells have many similarities in how they produce their highly diverse repertoire of…

A: Somatic hypermutation (or SHM) is a biological mechanism by which the immune system adapts to new…

Q: In Central America, it has been found that if natural forests are retained within and around coffee…

A: Win-Win situation It is a kind of situation when all parties are benefitted or are satisfied in some…

Q: 3. Label each part of a microtome and its function. B. 9 10

A: Microtome It refers to a cutting tool. It is used to generate thin slices of a substance called…

Q: explain properly. How is a species’ population dynamics affected by the presence of another species…

A: A species ecological niche can be defined as the range of resources and the conditions allowing the…

Q: Diffusion of gases occurs in the alveolar region only and not in the other parts of respiratory…

A: Each alveolus is composed of a thin layer of squamous epithelial cells that are highly permeable and…

Q: The technique used in bacteria for endospore staining can also be used to observe fungal spores.…

A: *Endospores staining is used to recognize presence of spore in bacterial cells This needs staining…

Q: Fragile X syndrome is an X-linked recessive Achondroplasia is an autosomal dominant trait…

A: Gene expression

Q: We were shown this specimen in an invertebrate zoology class. What is it? The professor told us…

A: It sure does comes under mollusks but I believe that this is not a Bivalve but a Chaetoderm, which…

Q: Under what circumstances could nonhomologous endjoining be said to be error prone?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: 4 4 -20 -15 -10 -5 0 Annual average temp T1. .1. of

A: Bergman's rule relates body size to the animal distribution according to the temperature. According…

Q: ppose hdt Certain Cells lounu are shown below. The resting membrane potential is -75 mV. Assume that…

A: 1. The layer potential How the resting layer potential is laid out in a neuron   Central issue A…

Q: What are the assumptions made during the calculation of net gain of ATP?

A: Several assumptions are made in order to perform theoretical calculations on ATP molecules, the most…

Q: Hermione's parents are muggles (cannot perform magic). How is it possible for Hermione to do magic?…

A: Wizards: ww muggles: Ww, WW Strong: MM (silencing gene) Strong magician: MM Moderate or normal…

Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…

A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…

Q: when two species exist on the same niche, how is the dominant species affected by the presence of…

A: Ecological niche It is the functional role of any species in a ecosystem or community. In other…

Q: Which tissue delivers dissolved sugar throughout the plant?Read and analyze the question and choices…

A: Plant tissue is a grouping of similar cells that collaborate to perform an organised purpose for the…

Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…

A: Since phenylketonuria is caused by recessive allele, we have,  People with genotype AA - normal /…

Q: Castle in industrial dairy farms are typically given RBS tea this animal hormone increases a cows…

A: Recombinant bovine growth hormone (rBGH) is a synthetic (man-made) hormone that is marketed to dairy…

Q: When a salmon or other teleost fish migrates from seawater intofreshwater, what are all the changes…

A: Teleosts are members of the Teleostei infraclass, which contains 96 percent of all extant fish…

Q: What is oxidative phosphorylation?

A: Introduction In this question we will discuss about the oxidative phosphorylation.

Q: outline major stages in life evolution, and describe how the landsurface changed as life evolved.

A: The period from 4600 mya to 2500 mya is called Archean eon.

Q: What is the root system of the ff. Mammillaria sp. Philodendron erubescens Phoradendron sp.…

A: Roots are the part of the plant that grow underground and absorb water and Minerals from the soil.…

Q: 19. Independent assortment of chromosomes is a result of which of the following processes? A) the…

A: As per Bartleby Guidelines experts are allowed to answer only 3 sub parts kindly post the other…

Q: below. What can we learn from this experiment about the rhythmicity of our cardiac muscle? List…

A: Cardiac muscles are the specialised involuntary muscles observed around the heart and are…

Q: Explain the following statement in 4-6 lines   1. Premalignant (hyperplastic or dysplastic) cells…

A: Cancer is an uncontrollable growth of cell. Cell multiply by the process know as cell division, by…

Q: .Which refers to all tissues outside the vascular cambium?Read and analyze the question and choices…

A: Plant has two main transport system - xylem and phloem. The xylem helps in transporting of water…

Q: Which of the following statements accurately describes the current state of biodiversity on the…

A: Biodiversity in an area depends on the number of species present in the area and the number of…

Q: Which of the following statements are correct? explain your answers.a. the hereditary information of…

A: Cells are the unit of life with independent survival.

Q: What is the correct order of appearance in the fossil record, starting with the earliest: flowering…

A: Fossils are the remains of living organisms that was found after the organism was buried properly.…

Q: Which is considered as the plant's first line of defense against physical damage?Read and analyze…

A: A plant's first line of defense against infection is the physical barrier that is in the epidermis…

Q: Free Response: Fruit Flies Genetics To do well on the question, you will need to use the proper…

A: In fruit flies, the phenotype for eye color is determined by a certain locus. E indicates the…

Q: Which test measures and evaluates the cellular component of blood?

A: Answer

Q: What is the mesentery? Why is it now being considered the 79th organ of the body

A: The “new” organ is called the mesentery, and absolutely everyone’s digestive tract has one. The…

Q: What method can be used to compare the transcriptomes of the individual single cells?

A: A transcriptome is a range of mRNA molecules that are expressed by an organism. It is a term that…

Q: (i) Why are both differentiation and self-renewal essential for the functioning of stem cells in the…

A: i) Stem cells are those cells which are responsible for the formation of different type of cells…

Q: A heterozygous free-lobed man is mated to a heterozygous free-lobed woman. What are the genotypes…

A: Genotype is the genetic makeup of an organism.  It consists of 2 alleles in an individual.

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: How does the sequence of the primary transcript resemble the sequence of the gene encoding it?…

A: The primary mRNA transcript is practical as soon as it's far synthesized. This is visible when…