Answered: When a salmon or other teleost fish…

When a salmon or other teleost fish migrates from seawater intofreshwater, what are all the changes that take place or are likelyto take place in its patterns of water–salt physiology?

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter12: The Urinary System

Section: Chapter Questions

Problem 10SQ: Match the following saltwater balance concepts:

See similar textbooks

Related questions

Q: Match the following (you may need to use your book or outside source). -Sacrum Ureter- Seminal…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: You have sequenced your new mouse model and identified a mutation that permanently activates the…

A: Introduction A mutation is a change in a DNA sequence base pair sequence due to various…

Q: DNA replication is a semi-conservative process

Q: . In a normal individual, heart rate can be determined by the in an ECG.

A: ECG stands for Electrocardiogram. It is a test which measures the electrical activity of heart.…

Q: Three major phylogenetic groups of Bilateria are currently recognized: Ecdysozoa, Lophotrochozoa,…

A: Since the drastic reorganisation of the phylogeny of the animal kingdom into three major clades of…

Q: in general, how does the location and abundance of regulatory DNA sequences change with increasing…

A: Introduction A genome is an organism's complete set of genetic instructions, It consists of…

Q: some cases, males or females do care for young of their own species that are not their own, as when…

A: There may be reason that adoptions fostering helped these females reproduce later on as Regular…

Q: How does the color of light affect the rate of photosynthesis

A: Photosynthesis is a process that occurs in all plants including bacteria and algae. They utilize the…

Q: The digger bee’s “postcopulatory courtship” consists of elaborate tactile stimulation that the male…

A: The digger bee’s “postcopulatory courtship” consists of elaborate tactile stimulation that the male…

Q: .c Osteoblasts

A: Bone remodeling involves the removal of mineralized bone by osteoclasts followed by the formation of…

Q: 3.Which hormone promotes ripening of fruits? Read and analyze the question and choices CAREFULLY;…

A: Ripening in fleshy fruits induces changes such as coloure development, softening, starch hydrolysis,…

Q: One of the main objectives of BI308 is to learn to think scientifically about animal behaviour. I…

A: Human behavioral ecology (HBE) is the study of human behavior from an adaptive perspective. It…

Q: How does having herd immunity important with your battle with the COVID- 19 pandemic

A: *Immunity is a complex of biological system which have the the capacity to recognize and tolerate…

Q: 1. Analyze the pedigree II II IV V

A: Pedigree analysis is a chart that represents a family tree showing the members of the family who…

Q: 13.Which region of the leaves is the location to which most of the photosynthesis takes place?Read…

A: Photosynthesis is the process by which plants use sunlight, water and carbon dioxide to create…

Q: Name the components of the formed elements in the blood and mention one major function of each of…

A: Blood is a consistently circulating liquid that provides nutrition, oxygen, and waste elimination to…

Q: Question 1. Why is DNA replication called semiconservative?

A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.

Q: • List 4 sources of genetic variation and explain how each source contributes to genetic variation •…

A: Population evolution Evolution is a prpcess of change and adoption for better survival in the…

Q: You are required to develop a detailed teaching plan for the sixth grade Blood circulation

A: Heart regulations

Q: 3. a. In the process of converting ADP to ATP, water is circle one: (REQUIRED / RELEASED) and…

A: Adenosine diphosphate(ADP) Important organic compounds in metabolism and is essential to the flow of…

Q: QlWhatis NAD yecycle.

A: ANSWER;-

Q: One of your classmates is planning to study endocytosis at neuronal synapses for their senior…

A: Introduction Endocytosis is the process by which the flexibility of the cell membrane enables the…

Q: what do you think is/are the reason/s why most of the clinical features of these diseases involve…

A: People with muscle diseases may experience muscle weakness, problems with moving and balance, and…

Q: а. WHY do prokaryotes use operons? b. Fill out the following table: Mechanism Requires/Uses Results…

A: A) An operon is a cluster of genes that are transcribed together to give an uncoupled messenger RNA…

Q: Fossils are remains of ancient organisms found in the rocks are categorized depending on their age.…

A: The remnants and evidence of ancient species are known as fossils. The preserved remnants or traces…

Q: Explain the following statements in 4-6 lines Humans are living longer, and that increases the risk…

A: Humans live a longer life than many other species. Humans have an average age of about 70 years.…

Q: Match each glial cell with its function + Schwann cells A. Help circulate cerebrospinal fluid *…

A: 1. B.Form myelin in the PNS 2. A Help circulate cerebrospinal fluidi

Q: 6. In the RBCS of the patient described above, which of the following would be expected A. ADP to…

A: Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates…

Q: Which is true about non-vascular plants?Read

A: Nonvascular plants are called bryophytes. Nonvascular plants include liverworts, hornworts, and…

Q: Whatresults in the specificity of an antibody (i.e. one antibody can bind only one particular…

A: Antibodies are proteins that are produced in the body in response to the encouter of foreign…

Q: Question 2a. The cartoon below shows a cartoon of splicing intermediates of the transformer MRNA in…

A: In Drosophilla, there is a gene called sex lethal genes or SXL, which codes for RNA binding protein…

Q: How does the presence of introns aid exon shuffling?

A: Exon shuffling is a mechanism, where two or more exons from different genes brought together, or…

Q: Why would it make sense for a bioprocess to have an upper specification limit, or USL, and to not…

A: Specification:The general definition is the range of expectations for a product to accomplish its…

Q: III. Mating System. Analyze the mating system of the swine industry as shown in the figure below.…

A: Question A. What would be the expected reproductive performance of F1 crossbred females compared…

Q: H. ntify the labeled parts of the reflex arc. |Choose (Choose (Choose (Cheo (Chooie (Cho

Q: In the buccal cavity of human being, digestion of which one of the following get started? 1. Protein…

A: The correct option is CARBOHYDRATES

Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…

A: Nuclear factor-κB (NF-κB), a transcription factor that is essential for inflammatory responses, is…

Q: The best source of active bone marrow from a 20-year old would be: A. Iliac Crest (hip) B. Femur…

A: Bone marrow It is the soft tissue that fills the centre of the bones. It aids in the production of…

Q: Complete the given Venn diagram by identifying the similarities (at the center of the intersecting…

A: Biodiversity refers to the variet of living organisms such as different species of micro organisms,…

Q: Nutrients (such as N, P. K) are important for the increase in net primary production which will be…

A: Different macro and micronutrients are responsible for inducing the growth and reproduction of the…

Q: 9. The dry type of ear cerumen ("wax") is due to homozygosity for a simple Mendelian recessive.…

A: Both allele and genotype frequencies will remain same in the population generation after generation…

Q: Which meristem, mainly found in the shoot and roots tips, is responsible for primary growth? Read…

A: apical meristem, region of cells capable of division and growth in the root and shoot tips in…

Q: Name of Transgenie Organism GM salmon, a.k.a. super saimon Possible Benefits from Transgenie…

A: Genetic engineering is a technique of biotechnology which uses recombinant DNA technology to alter…

Q: There are many immunotherapeutics now being used to immunomodulate recipients that are either fully…

A: Wellbeing and immunotoxicity appraisal of immunomodulatory monoclonal antibodies Most remedial…

Q: do any nematodes have similar adaptations due to their needs being met by their hosts

A: * Nematodes are the invertebrates called as roundworms which can be found in habit of marine and…

Q: Given that the multiplicity of infection of bacteriophage lambda to E' coti is greater than i.0,…

A: Introduction Even bacteria can get a virus! The viruses that infect bacteria are called…

Q: What are the types of molasses used in production of baker's yeat and what is the significance of…

A: Molasses is used as a microbiological energy source in a wide range of fermentation processes. It is…

Q: Describe how a morphogen acts in development.

A: Morphogen in development :-

Q: How would the patient's (lactate/pyruvate] ratio compare to the ratio in a normal infant? O The…

A: Gluconeogenesis is process by which the body generates glucose from non-carbohydrate precursors.…

Concept explainers

Physical and Chemical features

The physical property of a compound could be determined without modifying the originality of the compound. Examples of physical properties are density, hardness, color, boiling, and melting point. The chemical property expresses the ability of a compound to undergo a particular chemical change.

Question

When a salmon or other teleost fish migrates from seawater into
freshwater, what are all the changes that take place or are likely
to take place in its patterns of water–salt physiology?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe the interactions between the following water parameters:• Ammonia• Nitrite• Nitrate• Salinity• pH• Temperature,and explain the differences in the processes of osmoregulation between a freshwater fish and a marine fish.
What is the most important ion that determines water movement between compartments?
Match the following saltwater balance concepts:
Based on the physical laws of evaporation, explain why the highbody temperatures of mammals and birds make them prone tohaving higher rates of evaporative water loss than poikilothermicterrestrial vertebrates with lower body temperatures.
On a hot summer day, you decide to dive into a swimming pool.Before you begin your dive, you notice the surface of the water issmooth and continuous. After the dive, you discover that somewater droplets are clinging to your skin and that your skin temperature feels cooler. Explain these observations based on theproperties of water.
Young downstream salmon migrants moving from their freshwater natal streams into the sea leave an environment nearly free of salt to enter one containing three times as much salt as their body fluids. Describe osmotic challenges of each environment and suggest phys-iological adjustments salmon must make in moving from freshwater to the sea
List five routes of water loss. Which one accounts for thegreatest loss? Which one is most controllable?
The process of managing internal water/solute balance is known as: Hydrometering Osmoregulation Hydromation Fluid dynamics Aquamarine
Name the three buffer systems of the body. Which ofthese systems provides the largest proportion of buffercapacity?
Some animals living in water excrete nitrogen as ammonia. Land animals, which must conserve water, excrete urea or uric acid. How does excretion of these molecules aid in water conservation?
As CO2 levels in the water __________, the pH ______________. a. increase, increases b. increase, decreases c. decrease, decreases d. decrease, stays the same
water movement in and out cells is due mainly to fluctuation of the na+ and k+ ion concentrations