It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis. Select one: a. PAI b. Xenoy c. natural rubber d. collagen

Q: 4. General characteristics of water-soluble vitamins as components of human nutrition.

A: Vitamins are the organic compounds required in the diet in small amounts, for performing biological…

Q: a.       The importance of recombinant DNA technology in Environment  b.       Potential products…

A: DNA : Deoxyribo nucleic acid. It is a polymer which is composed of two polynucleotide chains that…

Q: 2. Aspirin can be absorbed into the blood through the cells lining the stomach and the small…

A: Aspirin is a drug that is used to reduce pain, antiinflammation, and fever. Aspirin is chemically…

Q: Which of the amino acids does NOT have an aliphatic side chain?   a.   Lysine   b. Alanine…

A: R groups in aliphatics are nonpolar and hydrophobic. The hydrocarbon chain's hydrophobicity rises as…

Q: 2. Biuret Test Color of 3% CuSO4 solution: Sample casein alanine albumin gelatin distilled water 3.…

A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…

Q: Describe the process of denaturation of protein.

A: The proteins are most active in their native structure. Native conformation of the protein is the…

Q: For the enzymes involved in producing ATP at an extremely high rate, please indicate the products…

A: ATP (adenosine triphosphate) is the energy currency that the cell uses in metabolic transactions.…

Q: Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two…

A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…

Q: You have discovered a new species of plant. You isolate chromatin from the plant and examines it…

A: Histones are basic proteins that are rich in basic amino acids like arginine and lysine. These basic…

Q: 1. What is the sequence of the heptapeptide produced upon treatment with trypsin? Fill each blank…

A: Specific enzymes have specific cleavage point in amino acids. Chymotrypsin is serine…

Q: actate dehydrogenase is a tetramer of MW 134000 g/mole composed of subunits which are equal in size.…

A: Lactate dehydrogenase belongs to the family of oxidoreductases. It catalyzes the conversion of…

Q: 14) Which of the following statements is true under the conditions provided: the enzyme…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Draw the Biosynthesis of fatty acids from Acetyl CoA pathway and identify the different types of…

A: The biosynthesis of fatty acids from the acetyl-CoA occurs in the cytosol. It involves the addition…

Q: Which of the following would you expect to happen if amino acids 579 to 582 (YIYV) in the PDGF-Beta…

A: PGDF beta-receptor contain multiple domains that activate the various pathways inside the cell. The…

Q: Vancomycin is a very potent antibiotic use for several diseases such as infective endocarditis,…

A: Vancomycin is a unique glycopeptide that is structurally unrelated to most common antibiotics. This…

Q: What is the net ionic charge for the peptide at pH 5 and pH 11? The peptide is…

A: A peptide is a short chain of amino acid residues linked via a peptide bond.  As a general rule of…

Q: Proteins in/on target cells that bind messenger molecules and cause a response in the cells are…

A: Proteins are made up of amino acids which are used as a monomer unit of proteins. 22 standard…

Q: Count Experiment Name: Specimen Name: Tube Name: Record Date: SOP GUID Display Range Population P1…

A: The flow cytometry data in the given image uses BV-605 as the fluorescent molecule. From the…

Q: Need help, please.

A: Malate dehydrogenase is an enzyme that catalyzes the final reaction of the TCA cycle. In the first…

Q: ATP is deemed the Universal currency for Cell, why do you think now it is the Fact

A: Energy-rich compounds are chemicals with specific structural characteristics that cause an energy…

Q: Qualitative Color Reactions Color Reaction Biuret Ninhydrin Xanthoproteic Millon's Intact Protein…

A: Hi! Thank you for the question. We are authorized to answer four subparts at a time, since you have…

Q: Glycolysis Glucose Pyruvate Pyruvate Oxidation Citric Acid Cycle Oxidative Phosphorylation (electron…

A: Introduction Cell requires energy for the various activities. Cell gets energy by cellular…

Q: 6. Analysis of Buffers in Unknown Solutions Imagine that you are given three different solutions:…

A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…

Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…

A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…

Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…

A:

Q: What is the product of the beta oxidation of this fatty acid?

A: The given fatty acid is caproic acid. Beta-oxidation is the oxidation of fatty acid on the…

Q: what 3 types of lipids exist? Give an example of each.

A: Introducion Lipid is a biomolecule consists of carbon, hydrogen, and oxygen. Lipids are water…

Q: draw all the structures of the tribasic amino acid lysine involved in the equilibrium reactions that…

A: The proteins are composed of 20 naturally occurring amino acids. The amino acids can be classified…

Q: What is the subject of the figure: What is the main message of the figure? Give a concise, complete…

A: Subject of the figure is point mutation of a base which leads to different translated product of a…

Q: The word root erythr/o means? Don't copy

A: The identification of affixes in biological terms can help in the understanding the complex terms.…

Q: Discuss why fluoroacetate can be called a mechanism-based inhibitor. what is a mechanism based…

A: Introduction Enzymes are known as bio-catalyst. They increases the rate of a chemical reaction by…

Q: In the absence of oxygen is glucose the major source of ATP?

A: It is generally agreed upon that ATP serves as the mediator of energy transfer between anabolism and…

Q: is albumin a macromolecule? if yes which type?

A: The biological macromolecules can be divided into four classes: the nucleic acids, the proteins, the…

Q: Provide a detailed plan and explanation on how to synthesize the following peptide by using Fmoc-…

A: Solid phase protein synthesis is a very powerful technique for the generation of synthetic oligo…

Q: Identify the oxidizing and reducing agent of the given equation: Answers should be the symbol of the…

A: An oxidising agent is a substance that gets reduced in order to oxidise other substance. A reducing…

Q: What is a codon, how many RNA nucleotides are in a codon, How many of these code for amino acids,…

A: Transcription is the process by which the genetic information stored in the DNA is copied onto an…

Q: Which one is not an example of supersecondary structure? the pyrrole ring O the Greek key the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 5. Bread contains mixture of polypeptides known as gluten. This polypeptide has two types which are…

A: The folding of a polypeptide chain into a three dimensional folded conformation can be divided into…

Q: 8. Phosphate buffered saline (PBS) is often used as an isotonic solution to keep cells happy and…

A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…

Q: Which of the following statements concerning SDS in SDS-PAGE is INCORRECT? a. SDS is a negatively…

A: SDS-PAGE is an electrophoresis technique used to separate protein molecules. Protein molecules can…

Q: The graph is an example of the rate of product production by an enzyme when the substrate is in…

A: An enzyme has substrate binding site. When substrate binds to that site, the reaction takes place.…

Q: The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine…

A: Alkaline hydrolysis is a process by which RNA is degraded dur to attack of -OH ions of alkali. The…

Q: The Worthington's manual reports two extinction coefficients for lysozyme. Corvert one into the…

A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Draw the Catabolism of triacylglycerols- beta-oxidation Pathway and identify different types of…

A: Fatty acids are transported into the cell. The enzyme fatty acyl-CoA synthase(FACS) adds a CoA group…

Q: 4. What effect do the presence of other materials in a mixture have on the Rf of a specific…

A: Chromatography is a biochemical technique that is used to separate a mixture of substances. In this…

Q: Even though HbA is a heterotetramer (not all the subunits are the same), the alpha- and beta-globin…

A: Haemoglobin is a carrier protein that carries oxygen to the cells . It is present in red blood cells…

Q: Select the answer with an INCORRECT statement about the hydrophobic effect It is important for…

A: Hydrophobic effect is the tendency of non polar molecules to interact with each other in polar…

Q: Draw and name an aldose and ketose having five (5) carbon atoms. Identify in your drawing the point…

A: Carbohydrates are a class of macromolecules that plays an important role as energy source for the…

Q: True or False: Phosphoryl groups are added to enzymes to increase their activity. *If this…

A: The enzymes are biological catalysts that are mostly protein in nature. The activity of an enzyme…