What is the product of the beta oxidation of this fatty acid?

Q: Question:- What is the standard state ∆G^(°') of the complete oxidation of the acetyl group in…

A: G is known as the gibbs free energy. The change in the free energy(∆G)of any reaction causes to…

Q: Which statement best describes the physiological role of the endocannabinoid system in learning…

A: The endocannabinoid system has become recognised as a key regulator of numerous brain activities.…

Q: DNA: What is palindromes and secondary structure?

A: Palindromes and secondary structure, both are terms that are related to the structural variation of…

Q: What is the major driving force that works in favor of tertiary protein structure formation (protein…

A: Proteins are the complex macro molecules that show four levels of structural organisation. They are…

Q: Drug X shown below is a kinase inhibitor used to treat multiple types of breast cancer. Breast…

A: As given in the question, Drug X is a kinase inhibitor used to treat multiple types of breast…

Q: The data in the table are used to create a calibration curve for the determination of RNA from ts…

A: In linear regression analysis, we examine whether one variable (called independent variable) can be…

Q: H3N-CH- OA ОВ What structure from above is the the conjugate base of the species A? Question 2 A O A…

A: An acid is a proton donor, a base is a proton acceptor. When a proton donor donates its proton, it…

Q: write out summary on:  Hemoglobin type of Anemia and affects on overall health.

A: Hemoglobin is a blood protein which binds to 4 oxygen molecule to form oxyhemoglobin to supply…

Q: Draw the Glycolysis (from glucose to two molecules of pyruvate) pathway and identify the different…

A: During glycolysis, one molecule of glucose results in formation of two pyruvate. Glucose is a…

Q: a.       The importance of recombinant DNA technology in Environment  b.       Potential products…

A: DNA : Deoxyribo nucleic acid. It is a polymer which is composed of two polynucleotide chains that…

Q: Consider the peptides and Met-Pro-Met-Asp-Lys-Lys-Val. Is the cyclic peptide with a peptide bond…

A: Met-Pro-Met-Asp-Lys-Val   is a peptide with below full names of the Amino acids : Met - Methionine ,…

Q: a) How many ionizable groups does the tyrosine-alanine-isoleucine-glycine tetrapeptide ustiloxin B…

A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…

Q: 10. Vitamin B6: coenzyme form, functional groups, mechanism of action, biological role, sources,…

A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…

Q: Increased NADH concentrations in the liver encourage gluconeogenesis. What do you think about this…

A: Gluconeogenesis is glycolysis run backwards with three new enzymatically catalysed reactions where…

Q: Classify the 13 known vitamins into water-soluble or fat-soluble vitamins.  Water-Soluble Vitamins…

A: A vitamin organic molecules essential for the proper functioning of the body. They are…

Q: Consider the following peptide to answer the questions below: A M A K K E S H I F T A I D E What…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Because of the helix dipole, the phosphate ions are likely to bind to a.   The side-chains of…

A: Function of a protein depends on it's three dimensional structure and structure of the protein can…

Q: Explain why condensed milk is not advisable to infants. 2. Enumerate the different kinds of milk.

A: Introduction Milk is the the primary source of nutrition for young mammals. It is a white colour…

Q: What are the extinction coefficient of Myoglobin (Equine) at 280 nm and 410 nm respectively?

A: Myoglobin is a conjugated protein that contains heme conjugated to globin chain. Myoglobin contains…

Q: 4. Cis peptide bonds are rarely found in proteins because they are about 8 kJ/mole less stable than…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Why does the velocity reach a plateau (asymptote) at high substrate concentrations?       a. At high…

A: Introduction Enzymes are known as biocatalyst. They increase rate of a chemical reaction by reducing…

Q: Identify basic structure of the 8 types of membrane proteins shown below Understand how primary…

A: All biological membranes share one common feature: they are impermeable to polar molecules and…

Q: What are riboflavin and niacin? Explain how these molecules are important to cellular metabolism.

A: The series of chemical processes that take place within cells in living things in order to sustain…

Q: Arginine has three ionizable groups. The pK of α-COOH is 2.18; α-NH 3 + , 9.09; and the R-group,…

A: Isoelectric point (pI) is the pH at which the net electric charge of the amino acid is zero. When,…

Q: 8) Explain translation from the perspective of an mRNA transcript.

A: Translation is a process of converting mRNA transcript into polypeptide. This process occurs in the…

Q: What would you predict about the ratio of hydrophilic to hydro- phobic amino acid residues in a…

A: Before getting into the calculations, we have to assume that our globular protein have a spherical…

Q: What interactions stabilize the formation of a ß-sheet from ß-strands? a) Salt bridges from charged…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: The active site of chymotrypsin indicates that the following residues are needed:   a.   Asp and…

A: Chymotrypsin is a digestive enzyme that helps to digest proteins in our food.  Chymotrypsin cleaves…

Q: 4 parts Which refers to A. breaking something down in the body. B.Building something in the body?…

A: In human body, numerous reactions goes on. This is called metabolism. Metabolism results from…

Q: Based on the functional groups in estrogen and testosterone, which would be more hydrophobic.…

A: Estrogen and testosterone are sex hormones.They are secreted by the gonads and regulate the…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: is albumin a macromolecule? if yes which type?

A: The biological macromolecules can be divided into four classes: the nucleic acids, the proteins, the…

Q: Which of the following statements regarding hydrogen bonding in secondary structures is true?…

A: A weak chemical link that exists between a hydrogen atom that is partly positively charged and an…

Q: 1. What is the effect of boiling in the test tube with starch solution and saliva?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 16) The graph at right shows the results of reaction rate vs. substrate concentration for a…

A: Since you have posted multiple questions we will answer the first question for you. If you want any…

Q: Which peptide has a larger pI? Arg-Gly-Gly-Gly or Gly-Gly-Gly-Arg   why?

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: b. You have 100 mLs of a 2 M histidine solution at pH 6.0, how many mls of a 5 M KOH solution must…

A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…

Q: Assumed that you have isolated the protein cytochrome C from a cell lysate. Discuss the advantages…

A: Cytochrome C Cytochrome C is a protein that is loosely bound to the inner membrane of mitochondria…

Q: Choose the best answer The active site of an enzyme is the place where the following happens:…

A: A catalyst is a component that speeds up a chemical reaction without really being a reactant.…

Q: explain in detail the oxidative phosphorylation in cellular respiration

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…

Q: Which of the following concerning hemoglobin is true? a) BPG decreases at high altitudes and causes…

A: 1 Hemoglobin is a globular protein, ie it is roughly spherical. It is an oxygen-binding protein that…

Q: what is the Vmax and Km  of the enzyme in the reaction

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: How can Nestle company help in fighting the obesogenic environment in Mexico with their food…

A: Mexico is the second most obesity affected country in the world.More than half of its youngsters and…

Q: Which of the following statements about aromatic amino acids is correct? (a) All are strongly…

A: Organic substances known as amino acids include both amino and carboxylic acid functional groups.…

Q: Describe the differences between lecithin and cephalin. Draw the structure of a glycerophospholipid…

A: Glycerophospholipids are a class of lipids found in all forms of life. It has Glycerol as its…

Q: Consider the oligopeptide whose structure is shown below: How many peptide bonds are there? Give…

A: please note that we are supposed to write only first 3 sub parts of a question. We request you to…

Q: A) What would you expect to happen if you added ddCTP to a DNA synthesis reaction in vitro in large…

A: ddCTP is 2',3'-Dideoxycytidine-5'-triphosphate. It does not contain a 3’OH group in the deoxyribose…

Q: (2) Determine the sequence of the peptide on the basis of the following data. Amino Acid…

A: Given that the peptide has 10 amino acids. The list of ten amino acids is as follows: Ile (I), Lys…

Q: Which of the following statements about alpha-helix and beta-sheet structure are true? More than one…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: 11. Match the following Sigmoidal curve ✓ Oxygen storage ✓ Contains heme Globular proteins Tetramer…

A: Haemoglobin is a transport protein that can transport oxygen to cells and tissues in the body.…