6. Consider an experiment in which cells are radioactively labeled by this method for only ashort period of time (about 30 minutes). The radioactive thymidine medium is then replacedwith medium containing unlabeled thymidine, and the cells are grown for some additionaltime. At different time points after replacement of the medium, cells are examined in amicroscope. The fraction of cells in mitosis (which can be easily recognized because theirchromosomes are condensed) that have radioactive DNA in their nuclei is then determinedand plotted as a function of time after the labeling with radioactive thymidine.labeled mitotic cells (%)10075-50250 bod0 510 15 20 25 30time (hours)a)Would cells at all phases of the cellcycle contain radioactive DNA immediatelyafter the labeling procedure? Why?b)Why are there initially no mitotic cells thatcontain radioactive DNA?c) Explain the rise and fall and then rise again of the curve.d) Estimate the length of G2 for these cellse) Estimate the length of the total cell cycle forthese cells

Introduction The cell cycle is the cascade of different events that leads to cell growth and…

labeled mitotic cells (%) 100- 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e) Estimate the length of the total cell cycle forthese cells

labeled mitotic cells (%) 100- 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e) Estimate the length of the total cell cycle forthese cells

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter10: Cell Division And Mitosis

Section: Chapter Questions

Problem 1ITD: Biologists have long been interested in the effects of radiation on cells. In one experiment,...

See similar textbooks

Similar questions

1. The production of arginine is terminated by the presence of excess arginine. State which phenomenon is responsible for this outcome. Explain the phenomenon in brief. 2. Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site. Do you think, the activity of an enzyme would differ from the wild type? 3. Which part of the cell has a model structure of a fluid mosaic? Why do you think this happens?
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
Biologists have long been interested in the effects of radiation on cells. In one experiment, researchers examined the effect of radium on mitosis of chick embryo cells growing in culture. A population of experimental cells was examined under the microscope for the number of cells in telophase (as a measure of mitosis occurring) before, during, and after exposure to radium. The results are shown in the Figure. What is the effect of radium exposure on mitosis? Source: R. G. Canti and M. Donaldson. 1926. The effect of radium on mitosis in vitro. Proceedings of the Royal Society of London, Series B, Containing Papers of a Biological Character 100:413419.
Which of the following is not true of somatic cell gene therapy? a. White blood cells can be used. b. Somatic cells are cultured, and the desired DNA is introduced into them. c. Cells with the introduced DNA are returned to the body. d. The technique is still very experimental. e. The inserted genes are passed to the offspring.
In 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients. His research was hailed as a breakthrough for people affected by degenerative diseases, because stem cells may be used to repair a persons own damaged tissues. Hwang published his results in a peer-reviewed journal. In 2006, the journal retracted his paper after other scientists discovered that Hwangs group had faked their data. Does the incident show that results of scientific studies cannot be trusted? Or does it confirm the usefulness of a scientific approach, because other scientists discovered and exposed the fraud?
A major difference between hereditary information in eukaryotes and prokaryotes is: a. in prokaryotes, the hereditary information is distributed among individual, linear DNA molecules in the nucleus. b. in eukaryotes, the hereditary information is encoded in a single, circular DNA molecule. c. in prokaryotes, the hereditary information is usually distributed among multiple circular DNA molecules in the cytoplasm. d. in eukaryotes, the hereditary information is distributed among individual, linear DNA molecules in the cytoplasm. e. in eukaryotes, the hereditary information is distributed amoung individual, linear DNA molecules in the nucleus.
In 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients. His research was hailed as a breakthrough for people affected by degenerative diseases, because stem cells may be used to repair a persons own damaged tissues. Hwang published his results in a peer-reviewed journal. In 2006, the journal retracted his paper after other scientists discovered that Hwangs group had faked their data. Does the incident show that results of scientific studies cannot be trusted? Or does it confirm the usefulness of a scientific approach, because other scientists discovered and exposed the fraud?
1.Why is mitosis also referred to as the equational division? 2. Where does the spindle fibre originate from?
1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase C.G2 Phase D.Prophase 2.Which of the following contains all of the components of a nucleotide? A.Sugar, phosphate, base B.Sugar, amino acid, base C.Amino acid, phosphate, base D.Sugar, phosphate, amino acid 3.What is meant by the description “antiparallel” regarding the strands that make up DNA? A.The 5’ to 3’ direction of one strand runs counter to the 5’ to 3’ direction of the other strand. B.The twisting nature of DNA creates nonparallel strands. C.Base pairings create unequal spacing between the two DNA strands. D.One strand is positively charged and the other is negatively charged.
1. A defective white blood cell does not complete the process of DNA replication. Which of the following is most likely to occur during the cell cycle for this cell? a. The white blood cell will be stopped at the G1 checkpoint and sent to the G0. b. The G2 checkpoint will stop the cell from continuing in the cell cycle. c. The white blood cell will get stuck at the spindle checkpoint. d.The cell will continue on to cytokinesis. 2. Which of the following statements describes how the RNA sequence specifies the production of an amino acid chain? a. Each set of three bases codes for an RNA molecule that specifies the anticodon. b. Each set of three bases codes for a single amino acid. c. Each base codes for one amino acid. d. Each group of three bases codes for an enzyme that binds amino acids together. 3. What will most likely happen when the -35 element and pribnow box are mutated? a. RNA Polymerase II will not be able to bind to the promoter region. b. Prokaryotic RNA…
1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…
1. Write if the statement is true and modify the statement with the correct answer if its false a.Blue colonies in the white-blue screening provide sufficient information on the transfer of recombinant DNA in bacterial cells. b.In blue-white screening, it is only the blue colonies that have survived the effect of antibiotics in the media. c.Bacterial transformation simply means the insertion of a recombinant plasmid into a bacterial cell. d.Competent cells are those bacterial cells that can accept the entry or re-entry of plasmids.