Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids in length. By convention, theamino acids within a polypeptide are numbered from the aminoterminalend to the carboxyl-terminal end. Are the following questionsabout lactose permease true or false?A. Because the sixty-fourth amino acid is glycine and the sixty- eighth amino acid is aspartic acid, the codon for glycine,64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68.B. The mRNA that encodes lactose permease must be greater than1241 nucleotides in length.

Q: Many of the loops on proteins are composed of hydrophilic amino acids. Why might this be the case?

A: Protein is one of the important biomolecules. This protein is made up of sequence amino acids which…

Q: Why is it no longer considered necessary to determine the Nterminal amino acid of a protein as a…

A: N-terminal amino acid : The N-terminal is the start of a protein or polypeptide referring to the…

Q: What useful information might you get if you did determine the Nterminal amino acid as a separate…

A: As we known proteins are composed of a long chain of amino acids that are joined by the peptide…

Q: Most proteins contain more than 100 amino acid residues. If you decided to synthesize a “100-mer,”…

A: Protein is a macronutrient that is essential to building muscle mass.

Q: What is the base sequence of the segment of DNA that is responsible for the biosynthesis of the…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: What do you mean by myristylated N-terminus?

A: N-myristoylation is the process in which myristic acid is attached to N-terminal glycine. It occurs…

Q: How would a substitution mutation in the third nucleotide position of the codons for alanine and…

A: A substitution mutation occurs when the specific bases (A,T,C or G) in a gene are swapped for…

Q: Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this…

A: Melting temperature of primer can be defined as a temperature at which one half of the DNA double…

Q: In the amino acid sequence below, the amino acid residue in red was shown to be essential to the…

A: Peptides or proteins are composed of twenty standard amino acids. These standard amino acids differ…

Q: The effect of base-pair substitution mutations on protein function varies widely from no detectable…

A: It is because of the protein functionality isn't affected by the mutations occurred in the intron…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: What is the Shine–Dalgarno sequence? What role does it play in protein synthesis?

A: The prokaryotic protein synthesis takes place in the ribosomes where the mRNA was translated into…

Q: Why do amino acids other than methionine occur in the Nterminal position of proteins from…

A: Translation starts with the binding of the ribosomal subunit to a sequence on the mRNA chain.…

Q: To see how many unique proteins, each composed of just two amino acids, can be formed from five…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: The purine and pyrimidine rings are built from the amino acids aspartate,glutamine, and glycine. Why…

A: A deoxyribonucleotide is a nucleotide that contains deoxyribose. They are the monomeric units of the…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: Which of the following amino acids is most unlikely to be present in a beta sheet? O Leucine O…

A: Beta sheet consist of beta stands connected by atleast 2 or 3 backbone hydrogen bond laterally which…

Q: Consider a mutation that results in a substitution of Cysteine (CYS) ) for Tyrosine (TYR) at…

A: Cysteine is a polar amino acid.  Cysteine is a triprotic acid with three ionizable functional…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…

A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…

Q: The pK1, pK2, and pKR of the amino acid lysine are 2.2, 9.1, and 10.5, respectively. The pK1, pK2,…

A: Proteins can be successfully separated using many different techniques. Chromatography is the…

Q: Why is selenocysteine called the 21st amino acid when there are many more amino acids found than the…

A: Introduction: The 21st proteinogenic amino acid is selenocysteine. It is an essential amino acid.…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…

Q: a. The three amino acids with the highest Blosum-62 values are histidine, cysteine and tryptophan.…

A:

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: Why is it no longer considered necessary to determine theN-terminal amino acid of a protein as a…

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: what are the two dipeptides that can result from the reaction of zwitterions of this amino acid and…

A: A polymer of amino acids is known as Peptide. A dipeptide is a polymer of amino acids containing…

Q: Draw a structural formula for a nucleoside composed of the following. Q.) a-d-Ribose and adenine

A: Nucleosides are glycosylamines that are made up of nitrogenous base (purine or pyrimidines) and…

Q: Why is gluose broken down in a series of steps?

A: Glycolysis is the process of breaking down a glucose molecule into two pyruvate molecules. Here, a…

Q: Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide…

A: The amino acids that form peptide chains can be either polar/non-polar, charged/uncharged,…

Q: Four of the most abundant amino acids in proteins are leucine, alanine, glycine, and valine. What do…

A: Amino acids are the building blocks of proteins. these are the organic components when proteins are…

Q: For the m-RNA  nucleotide codons given below, what is the corresponding sequence of amino acids?…

A: mRNA is also called as messenger molecule which is produced by RNA polymerase. The mRNA is produced…

Q: What types of interactions/bonds/forces are polar amino acids able to form when a polypeptide is…

A: Polar amino acids are those amino acids that have side-chains capable of residing in an aqueous…

Q: What is the significance of the pentose monophosphate shunt to synthesis of nucleotides?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Considering prokaryotes, what is the term for the triplet of nucleotides that codes for an amino…

A: Asked : Term for the triplet of nucleotides that codes for an amino acid

Q: Which amino acid sequence will be generated?  5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'

A: During translation mRNA is translated into amino acid sequence, by the help of various enzymes, tRNA…

Q: Draw the tetrapeptide Met-Ile-Lys-Glu at a ph of 7?

A: The pKa values of amino acid side chains play an important role in determining the pH-dependent net…

Q: How do you calculate the pI value of glutamic acid and histidine? What is the importance of…

A: The pI value is the pH at which amino acid has a net charge of zero. It is known as the isoelectric…

Q: What aminos acid would the anticodon GAC be translated into?

A: * DNA will have four nucleotides  Adenine Guanine Cytosine Thymine * RNA will have four…

Q: Draw and label the following RNA tetranucleotide: 5'phosphoryl-A-2'O-methyl-C-U-G-3'- phosphate.

A: A tetranucleotide is sequence of four base pairs in RNA (ribose nucleic acid) is known as RNA…

Q: What is the effect of the altered amino acid sequence in Hb S that causes the cells to form sickle…

A: Introduction: Sickle cell anemia is an inherited disorder in which the shape of red blood cells…

Q: If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what…

A: Polynucleotide with ribonucleotides as mononucleotides is known as a polyribonucleotide. Nucleic…

Q: What useful information might you get if you did determine the N-terminal amino acid as a separate…

A: N-terminal amino acid : Within a peptide, the amine group is bonded to another carboxylic group in a…

Q: When the amino acid sequences of insulin isolated from differentorganisms were determined, some…

A: Nucleotides are natural molecules comprising of a nucleoside and a phosphate. They fill in as…

Q: What tetrapeptide is synthesized from the informational DNA sequence G-T-C-A-G-T-A-C-G-T-T-A?

A: To manufacture protein molecules, a cell must first transfer information from DNA to mRNA through…

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.