less than 2% of the human ________ consists of codonswithin genes;

Q: three similarities and three differences between Long noncoding RNAs and Pseudogenes

A: A non-coding RNA is an RNA molecule that isn't converted into a protein. The DNA arrangement from…

Q: five steps to solving a genetic problem.

A: Genetics is the branch of science that de las with the study of inheritance of a characters from…

Q: Which of the following organisms would NOT have introns in their protein-encoding genes? humans…

A: DNA or deoxyribonucleic acid is the genetic material found in different organisms. Genes are the…

Q: A gene is made up of (choose one: RNA, protein, DNA, carbohydrate).

A: A gene is the functional unit of inheritance. These are made up of DNA.  These genes contains…

Q: The knowledge gleaned from the normal human genome's DNA sequence concerning WDR62's function.

A: Genome is the complete genetic material present in the cell. It is made up of double stranded chain…

Q: Mitochondria and chloroplasts have their own bacteria-like genomes in the form of double-stranded…

A: The given statement is TRUE.

Q: An insertion of two nucleotides into a gene results in a frameshift mutation.  This statement is:…

A: The nucleotide sequences found within a DNA molecule are subject to change due to a phenomenon known…

Q: This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3'…

A: CGU is the correct answer.

Q: Unclassified Intergenic DNA Occupies a Significant Portion of the ___________.

A: Answer: Introduction: Intergenic DNA contains any DNA which is 5′ or 3′ from the start or stop…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: The DNA molecules in eukaryotes including humans are negatively supercoiled while that in…

A: Genetics is a part of science worried about the investigation of qualities, hereditary variety, and…

Q: True or False: 1. In DNAs, the amount of adenines always equal to the amount of thymine and…

A: DNA It is a nucleic acid molecule which constitutes two polynucleotide chains wound around each…

Q: The Eukaryotic Chromosome Consists of a Linear DNA Double Helix Bound to Proteins

A: The DNA helix is wrapped around proreins to form Nucleosomes.

Q: DNA RNA Chromosomes

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: - sequence is there an error in the DNA

A: The advent of technology has lead to discovery of structure of DNA by Watson and Crick in 1950. This…

Q: The extra chromosomal, self-replicating, closed, double stranded and circular DNA molecule is…

A: In biotechnology vectors are DNA molecules which carry a foreign DNA fragment when inserted into…

Q: In the living organisms, genetic mutation occurs in Protein, RNA and DNA in the cell. *

A: Mutations are changes in the DNA molecule that arise due to errors during DNA replication or…

Q: Genetics - multiple choice -

A: Question 1 - Option (d) is correct = autosomal - humans have 22 pair of autosomal chromosomes and 1…

Q: To examine: Whether the given statement, "most of the DNA sequences in a bacterial genome code for…

A: Nucleic acids are heritable genetic material. Nucleic acids are nucleotide polymer. Nucleotides are…

Q: Which of the following is present in prokaryotes but not eukaryotes?a. exonsb. polyribosomesc.…

A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…

Q: ONE gene for the betterment of human kind, which one would be better and why?

A: Genes are responsible for variety of characteristics and quirks we have  Genes are the source of…

Q: The xenobiotic molecule ethyl chloride (CH3CH2Cl) is mutagenic. To what class of mutagenic…

A: The term xenobiotic is composed of two words, “Xenos” meaning “foreign” and “biotic” meaning…

Q: The genome’s functional gene products are either _____________ or _____________.

A: Genome is the total amount of genetic material that was present in the living organism which…

Q: the sequence of amino acids coded for by the following sequence of bases in a strand of Jse the…

A: The final step of gene processing in which the codons of mRNA are decoded by the tRNA inside the…

Q: Transcription and translation can happen in prokaryotes at the same time. True False

A: Transcription is the process by which a double stranded DNA is converted into a single stranded RNA.…

Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3

A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…

Q: Codons are...

A: Three nitrogen bases that code for a single amino acid are known as a codon. Codon show some…

Q: Human females have 23 different chromosomes, whereas human males have 24. Is this statement true or…

A: *As per our company's guidelines we are supposed to answer a single question at a time. Please…

Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…

A: The DNA is the genetic material of  the living organisms like humans. This molecule carries the…

Q: This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3'…

A: Codons are a sequence of nucleotide DNA or RNA that occurs in groups of three or triplets. each of…

Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…

A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…

Q: Viruses from which organism contributed the most RNA to the H1N1 influenza virus shown at the bottom…

A: H1N1 viruses are one of the three subtypes of human influenza viruses. These viruses have segmented…

Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome

A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…

Q: Most RNA molecules have three phosphate groups at the 5′ end, but DNA molecules never do. Explain…

A: The first nucleotide of the RNA is triphosphate because the triphosphate is not cleaved at the first…

Q: True or False: DNA can be copied outside a living cell. ___________

A: Dna is the genetic material and dna replication is the process where copies of dna are formed and it…

Q: Innoor an A |RROTEL HERE........god ba

A: In this question we have to describe about the process of translution.

Q: The “start” codon is ____ - ____ - ______

A:

Q: Long interspersed nuclear elements (LINES) found in eukaryotic genomes

A: Correct Option Transposons that can copy themselves and move around the genome

Q: Doctor Kryskowski: The autosomal dominant mode of inheritance and symptoms found in the patients…

A: Asked : Most feasible way to detect the given syndrome

Q: The Central dogma for biology includes: DNA to RNA which is called

A: Central Dogma is one of the most important concepts in Biology which involves the processes in which…

Q: • Nearly half the human genome is made up of which elements

A: A genome is an organism's complete set of deoxyribonucleic acid (DNA), including all of its genes.…

Q: DNA within a prokaryotic cell is found in a(n)

A: DNA in a prokaryotic cell is found in a central area called nucleoid and it is not surrounded by a…

Q: Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct…

A: Yes, mitochondrial DNA is a kind of DNA found in the mitochondria. It is different from the DNA…

Q: Statement 1: Gene cloning is a process used to obtain many copies of a particular gene or large…

A: Answer : Option (1) is correct. Both statements are true.

Q: What is the function of reverse transcriptase?

A: BASIC INFORMATION CENTRAL DOGMA  It is basically the process which tell us the unidirectional flow…

Q: QUESTION 1 RNA Polymerase is the enzyme responsible for DNA replication O True False QUESTION 2 RNA…

A: As per the guidelines we are supposed to answer only the first question in case of multiple posted.…

Q: The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes…

A: Point mutations are a broad group of mutations that explain a shift in the DNA single nucleotide, so…

Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…

A: Introduction  Epigenetics is the study of how changes in your environment and behaviour can have an…

Q: The mRNA codon of valine is GUC UGG CCA TTG

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.