All of the aboveQUESTION 33Codons are...O Ambiguous - there can be more than 1 that codes for particular amino acidsNot redundant - there is only one codon for each amino acidSemi-conservative - each complete strand is derived from a parent strandUniversal- codons in bacteria, plants, and animals code for the same amino adAll of the above are correctQUESTION 34A bact

Three nitrogen bases that code for a single amino acid are known as a codon. Codon show some…

Answered: Codons are...

Science

Biology

Codons are...

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 4RQ: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains...

See similar textbooks

Related questions

Q: Define exon and intron.

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: How can two DNA fragments pair with each other?

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: How would you make a copy of DNA from an mRNA transcript and what is this molecule called?

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: People used to think that the genetic code could be found in proteins, because there are so many.…

A: Genetic code It is defined as the set of rules through which the information in the genetic material…

Q: What is an intron?

A: The genetic information of all living organisms is stored in the DNA. The specific sequence of DNA…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Is it reasonable that codons for the same amino acid have one or two nucleotides in common? Why or…

A: Proteins are synthesized via translation of mRNA> The tripeptide sequence on the mRNA that codes…

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: How tRNA responds to redundant codons?

A: During the process of translation, tRNA gets charged by picking up particular amino acid. The…

Q: Does a sequence contain a gene?

A: DNA stands for doexyribonucleic acid which is made up of phosphate group, sugar group and…

Q: What do you mean by post translational folding?

A: Protein folding takes place in the endoplasmic reticulum and proteins folding an important process…

Q: What is Exons C

A: Exons are nucleotide sequences in DNA and RNA that are conserved in the creation of mature RNA.…

Q: 17. The genetic code

A: The above given statement is about genetic code.

Q: What do you mean by initiator codon ?

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: The job of a ribosome is to?

A: Answer

Q: Describes an anti-codon?

A: According to Central Dogma :- Genetic instructions are transferred from DNA to RNA and then RNA to…

Q: Explain the properties of nucleosomes ?

A: The nucleosome is the fundamental subunit of chromatin. It helps in compaction of long eukarytic…

Q: What are the components of a nucleosome?

A: Step 1 Human beings have 46 chromosomes which occur in the form of chromatin in the nuclei. The DNA…

Q: Explain the difference between an intron and an exon.

A: RNA splicing is one of the processes of post-translational modification in which introns are removed…

Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…

A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…

Q: What will happen in a cell if the DNA ligase gene is mutated

A: DNA ligase is an enzyme which is responsible to join DNA fragments which are discontinuous. This…

Q: Why are introns called introns?

A: In eukaryotes the template strand of DNA gets transcribed into pre-mRNA by the process known as…

Q: What do you mean by mRNA and tRNA?

A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…

Q: Why could a codon not consist of only two bases?

A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: What are introns? Where are they located in the DNA?

A: Introduction :- Before an RNA molecule is translated into a protein, non-coding portions of the RNA…

Q: Each nucleosome contains

A: Answer - Option A - Eight histones

Q: Why does DNA replication produce two daughter strands that are identical to each other and to the…

A: DNA replication occurs in S phase. DNA replication occurs in 5’ to 3’ direction. DNA replication…

Q: If one codon codes for two nucleotide than how many possible codons are there?

A: To find: How many codons are possible if one codon codes for two nucleotides

Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?

A: The process of transcription starts as the DNA of a gene serves as a template for complementary…

Q: What are introns? What is the functional importance (if any) of introns?

A: The information regarding the content of genes is in the specific sequences of nucleotides. Most…

Q: What is an intron and an exon

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: Describe the composition and structure of the nucleosome.

A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…

Q: How many nucleotides in a row make one codon?

A: A codon is a sequence of DNA or RNA nucleotides that corresponds with a specific amino acid.

Q: What are introns?

A: DNA- It is genetic material, also known as Deoxyribonucleic acid. The second carbon has a 2'H, which…

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: What is the function of a nucleosome and where is nucleosome found?

A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…

Q: Describe the structure of the nucleosome

A: In eukaryotes, DNAs are condensed and packed along with several proteins to form the chromatin…

Q: start codon and stop codon

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…

A: The genetic code is a system of principles that live cells employ to convert data contained in…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: What is known synthesized DNA is called the leading strand?

A: The hereditary ingredient in the cell is the genetic material. DNA is present in the nucleus of…

Q: Define the terms codon and anticodon, and list three start and stop codons.

A: Codon and Anticodon plays an significant role in the transcription and translation of the DNA and…

Q: what is a genetic code and what are its main features

A: DNA aur RNA carries all genetic information .it is expressed in the form of proteins which are made…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.
Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
1. The below strand is a normal polypeptide. Using the below base sequence and amino acids,draw an example of each of the following (show bases and resulting amino acid sequence)a. silent mutationb. missense mutationc. nonsense mutationd. frameshift mutation 5’ AUG – GCC – AGU – GAA - CAU – AAU – AGU – AGA – UAA 3’Met - Ala - Ser - Glu - His - Asn - Ser - Arg - stop
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint: Polarity matters a) 5'-TAC-3' b) 5'-CAT-3' c) 5'-UAC-3' d) 5'-CAU-3'
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acid
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'