Let's Explore This module we will be discussing about the DNA and mRNA and its role in performing a very important task of transferring codes to proteins that will be manifested in the body. But first, let's have this quick activity to get to know DNA ad MRNA well. LET US PAIR! The sequence of bases in one DNA / RNA (indicated per item) strand is given below. Identify the complementary sequence of bases in the other strand of DNA/RNA. The first one is done for you. DNA RNA A always paire with A alveays pairs with U C always p airs with G C alvrays p airs veith G DNA: T G. 1. DNA: 2. RNA: 3. DNA: 4. RNA:

Let's Explore This module we will be discussing about the DNA and mRNA and its role in performing a very important task of transferring codes to proteins that will be manifested in the body. But first, let's have this quick activity to get to know DNA ad MRNA well. LET US PAIR! The sequence of bases in one DNA / RNA (indicated per item) strand is given below. Identify the complementary sequence of bases in the other strand of DNA/RNA. The first one is done for you. DNA RNA A always paire with A alveays pairs with U C always p airs with G C alvrays p airs veith G DNA: T G. 1. DNA: 2. RNA: 3. DNA: 4. RNA:

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Practice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
58Which of the following is not one of the hypotheses that were considered by Fire and coworkers for how double-stranded RNA silences worm genes? A.double-stranded RNA destabilizes mRNAb.double-stranded RNA directly degrades specific mRNAc.double-stranded RNA inhibits gene transcriptionD.double-stranded RNA alters the target DNA 59Walter Gilbert coined the term ( ) for an intervening sequence that is removed during the conversion of a primary transcript to a mature RNA. 60RNA polymerase II requires the assistance of general ________________ to transcribe naked DNA from specific transcription sites. A.enhancersb.repressorsc.promotersD.transcription factors
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
https://ny.pbslearningmedia.org/resource/biot09.sci.life.gen.epigenetics/epigenetics/ In what way do the brown and yellow mice shown in the video differ?Why is this so?
To construct an “interactome” like the one shown inFigure 9-21, scientists identify all of the protein interactions in a particular tissue or cell type. Comparison ofinteractomes from human muscle versus human braintissue reveals very different patterns. If you were the scientist involved in this study, how would you explainthese results?
Transcribing and translating transcribe and translate the following DNA molecules DNA:GCTAGTACGTGCACATTAGAA mRNA: amino acids:
How alternative splicing partially explainswhy the diversity of human proteins vastlyexceeds the number of human genes