Q: 1) Figure 20 shows that the European otter (Lutra lutra) and the American badger (Taxidea taxus)…
A: Introduction phylogeny is the study of a species' or group's evolutionary history, particularly in…
Q: chymotrypsin
A: Chymotrpsin: It is a digestive enzyme which breaks down polypeptides. It consists of a catalytic…
Q: Explain the Organization of the Thylakoid Membrane ?
A: The photosynthesis process takes place within the chloroplast of plant cells. Chloroplasts are well…
Q: position 480 to arginine (G480R) in the FGFR protein. Normally, FGFR is active when FGF binds to it…
A: Achondroplasia is an inherited autosomal dominant disease. This occurs due to a gene mutation that…
Q: What is the purpose of the "sodium/potassium pump" A. to perform endocytosis. B. to move sodium and…
A: Sodium/potassium pump: The sodium/potassium pump is referred as an enzyme that is found in the…
Q: Section E. The Secondary Tissues of Roots in Woody Dicots Identify and label these parts in old…
A: Introduction In vascular plants, a vascular bundle is a component of the transport system. The…
Q: 160 140 120 100 80 60 40 20 1845 1865 1885 1905 1925 Time (years) (a) Based on the graph, identify…
A: The relationship between the lynx and the snowshoe hare is a classic example of the predator-prey…
Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…
A: Man with Chronic myeloid leukemia treated with imatinib therapy :-
Q: What are tyrosine kinase and GPCR? Give example of one pathology that can occur in…
A: Tyrosine kinase and GPCR dysregulation and rescue :-
Q: Polymerase movement RNA POLYMERASE -Nucleotide being added to the vijend of the RNA RNA NTPS RNA-DNA…
A: i) - 5'- ii)- Template strand/Sense Stand iii)- Region of DNA unwinding iv)- Codon strand/Antisense…
Q: What is the mechanism behind the success of vaccines to eradicate or reduce infectious diseases such…
A: Vaccination refers to the process of immunizing individuals before they get infected with a disease.…
Q: The habit of a perennial plant's dropping its leaves, which have all died, at the end of the growing…
A: The answer is d. Deciduous
Q: the angle formed by the rest and :the minor connector should be less than 90° .More than 90° less…
A: A minor connector is the connection among an RPD's primary connector or base and the prosthesis'…
Q: 1. Male and female animals have a pair of gonads. What advantages does it provide to the species? 2.…
A: We are only allowed to do upto 1 questions or three subpart of a question. Please repost the undone…
Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides
A: Introduction - A gene is a basic unit of heredity in biology, as well as a sequence of nucleotides…
Q: QUESTION 22 Which of these statements is false? O Physical activity increases the risk of adverse…
A: One of the reasons for the rapid rise in obesity in adults and children is the inexpensive…
Q: How is cystic fibrosis inherited
A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…
Q: 4. Which of the following statements about cortisol is incorrect? A. It cooperates with the…
A: Cortisol, the primary stress hormone, raises blood sugar (carbohydrate), improves glucose…
Q: Where do optometry work? eg private/small business operators; large health service systems eg…
A: Introduction Optometry:- It is a healthcare profession which involves examining the eyes and related…
Q: Types of Reproduction (Sexual or Asexual) Organisms Method of Reproduction 1. Hydra 2. Banana 3.…
A: Budding is hydras' most frequent asexual reproductive technique. Buds emerge from the point where…
Q: of Traits and Species Rhesus Snapping Kangaroo Lamprey Bullfrog Human Tuna Monkey Turtle Dorsal…
A: Cladogram A cladogram is the phylogenetic tree representation that depicts the evolutionary…
Q: What is eusociality and list down some characteristics of a eusocial system?
A: There are levels of society defined in the text, the highest being the Eusociality.
Q: Differentiate Kin selection from altruism.
A: View point of Kin Selection:- It believes that reproductive success is the main goal (for other…
Q: When 1.6 million year old Nariokotome/Turkana skeleton was recovered near Lake Turkana in Kenya.…
A: This shows that the discovered skeleton was a preadolescent.
Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…
A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…
Q: Which of the following statements best describe the equation P = G + E + (G X E)?* a. The…
A: Introduction The term "phenotype" refers to an organism's visible physical characteristics, such as…
Q: Instruction: Observe the process used in plant and animal reproduction. A. Put a Check (/) if the…
A: Self pollination of a flower will cause no or very minute variation. The reason is here it uses its…
Q: A worker in a nuclear power station receives the following radiations while working in 1 year: 85mGy…
A: Introduction :- Radiation is energy that originates from a source and travels at the speed of light…
Q: acrial sporophyte alternation of generation antheridjum collumella cuticle elaters hydroids…
A: Plants are photosynthetic , autotrophic organism that belongs to plant kingdom . It mainly comprises…
Q: answer 1,2,3,4,5,6,7 and 8. 1. Diphyllobothrium latum 2. Taenia saginata 3. Taenia solium 4.…
A: Answered 1234
Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…
A: Given: Vmax of pigeon and pheasant, the enzymes such as Hexokinase, Glycogen phosphorylase,…
Q: shark and sheep brains
A: The CNS (Central Nervous System) comprises of Brain and Spinal cord. Structure of…
Q: 1.To study mitosis, what is the best time to harvest onion root tips and why? 2. Other than an…
A: In mitosis, the nucleus of the eukaryotic cells divides into two, that subsequently results in the…
Q: Please help explain this sentence Identification of DAXX as a restriction factor of SARS-CoV-2…
A: To identify restriction factors limiting SARS-CoV-2 replication, we generated a pool of A549-ACE2…
Q: What is the purpose of the "sodium/potassium pump" A. to perform endocytosis. B. to move sodium and…
A: The plasma membrane is selective barrier of the cell that regulates the transportation of different…
Q: indicators, key used for/ determines reagents, or key positive result ingredients |1. crystal violet…
A: NOTE: Once you have posted a question that has multiple subparts, we will be solving the first three…
Q: Bacteria use the following mechanism(s) to resist antibiotics:
A: Antibiotic resistance Antibiotic are the class of compounds that inhibits the growth of bacteria or…
Q: Drugs that interfere with sympathetic nerve signals are often prescribed for men who have high blood…
A: Nervous system The nervous system of the body is the complex system that controls and coordinates…
Q: What is NADP and NADPH?
A: Introduction - Plants can create ATP through a similar process during the light reactions of…
Q: What do you think will happen if human cells becomes motile?
A:
Q: What is the difference between genotype and phenotype? 2. A black guinea pig is mated to a white…
A: Alleles are the alternative form of a gene that are located on the same locus of homologous…
Q: ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein…
A: pGLO: pGLO is an engineered plasmid that contains genes for beta- Lactamase. Beta-lactamase…
Q: Diseases of the female reproductive system are generally treated by a physician called a The male…
A: The testes are important for creating sperm and manufacturing testosterone, the principal male sex…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Both cartilaginous and bony fishes have_ a. jaws d. a swim bladder b. a bony skeleton e. a…
A: The name vertebrate comes from the Latin word vertebrae, which refers to the spine's bones. Animals…
Q: SPOI.
A: The principle cytotoxic lesion for radio-mimetic chemicals and…
Q: I> 00 1> HB 8001 LO6_HumanMolecularGenetics - Saved to this PC A Danielle Gr Design Layout…
A: With one gene controlling a trait we have three possible genotypes, AA, Aa and aa. Out of these two…
Q: The small opening in the integument(s) of the angiosperm egg sac through which the pollen tube…
A: Answer is e. The micropyle
Q: produced by a bird that flies.
A: Example of flightless birds that cannot fly are ostrich, Kiwi and emu. The birds that are able to…
Q: Nature Picture Library Aristolochia old stem, x.s.
A: Monocots plants are that contain single cotyledons in the seed while the dicot has two cotyledons in…
List some of the variations in eudicot leaf structure.
Step by step
Solved in 2 steps