PolymerasemovementRNA POLYMERASE-Nucleotide being addedto the vijend of the RNARNANTPSRNA-DNAhybrid region32. Refer to the transcription bubble diagram (above) to fill in the blanks.5'-3'-Template strand/Sense strandCoding strand/Antisense strandRegion of DNA unwindingRegion of DNA rewinding

The sense strand, or template strand, is the only strand that is effectively employed as a template…

Answered: Template strand/Sense strand Coding…

Science

Biology

Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA rewinding

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 16P

See similar textbooks

Related questions

Q: 9. Which of the following statements about meiosis is correct? A. Gametes are haploid cells…

A: Meiosis is a type of cell division in which the parent cell is divided into four daughter cells such…

Q: A patient most likely presents with chronic myeloid leukemia (CML) and you have a fullI blood cell…

A: Chronic myeloid leukemia (CML) is also known as 'chronic myelogenous leukemia', is an uncommon type…

Q: State the three main functions of the digestive system.

A: Digestion involves two aspects- mechanical digestion and chemical digestion. Mechanical digestion is…

Q: In Mendel’s terminology, a “true-breeding” variety of a particular plant: a. Has a homozygous…

A: Introduction Breeding is the sexual reproduction of animals or plants that results in progeny. It…

Q: Which of the following is not true about the premise of a dose/response relationship? A There is a…

A: ANSWER;- LD50 is the inverse square of the dose Explain;- LD means "Lethal Dose". LD50 is how much a…

Q: Case fatality rate. Based table 1, what conclusion can you draw about the risk of acquiring…

A: Tuberculosis (TB) is caused by bacteria Mycobacterium tuberculosis that most affect the lungs.

Q: Describe the step-by-step procedure of passage cells.

A: Cell passaging or splitting is a technique that enables an individual to keep cells alive and…

Q: Give meanings for the following abbreviation: 1. OU – Both Eyes 2. VA - 3. OD - 4. OS - 5. VF - 6.…

A: Medical terminology is language used to describe anatomical structures, procedures, conditions,…

Q: Explain whether the micrograph shown in the question is a stem or a root that belongs to eudicot or…

A: Dicotyledons, or simply dicot, are plants with two cotyledons or embryonic leaves in their seeds.…

Q: The pituitary gland is often referred to as the master gland. Set aside the fact that this term is…

A: The pituitary gland is a small gland near lower area of the brain that is about the size of a…

Q: In sulfur photosynthetic bacteria what is the molecule that donates hydrogen for photosynthesis?

A: Introduction - Sulfur-oxidizing bacteria are prevalent. Thiobacillus thiooxidans is a…

Q: By looking at the picture above, describe the events that take place during fertilization up to the…

A: Fertilisation is q process of fusion of male and female games resulting in the formation of a…

Q: Please answer asap and in short Outline and summarise each of the four stages of qualification in…

A: Although a scale-down bioreactor can have multiple applications, our focus here is on appropriate…

Q: Describe 5 examples of biological processes that can cause DNA supercoil?

A: Supercoiling This process takes place to relieve the helical stress in the molecule through twisting…

Q: Which of the following post-translational modification(s) anchor(s) the protein to the biological…

A: By covalently adding functional groups or proteins, proteolytic fragmentation of regulatory…

Q: chymotrypsin

A: Chymotrpsin: It is a digestive enzyme which breaks down polypeptides. It consists of a catalytic…

Q: The following statements are correct except* a. Assimilates are transported from areas of supply to…

A: Food, primarily sucrose ( assimilate) is transported by the vascular tissue of phloem from a source…

Q: What is the comparison between acrylic and chrome cobalt

A: Dentures are the frames that hold one or more artificial teeth together. These are the prosthetic…

Q: 6. Draw changes in potential in the wet bone during cyclic compression. 7. Can the flow potential be…

A: There are few important points that should be kept in mind : As we know that bone tissue consist of…

Q: Discuss the THREE (3) main stages crucial to microbial leaching of copper from a low-grade ore,…

A: Bioleaching involes microorganisms .Main copper minerals include sulfides, (CuFeS2) chalcopyrite,…

Q: What is the PAR receptor?

A: In biology, receptors are chemical structures made up of proteins that aid in signal transmission by…

Q: ➢ Is the tripartite body plan of phoronids advantageous for them? Why or why not? ➢ Why is the…

A: Phoronids Phoronids are also known as horseworms. These are small marine organisms of the animal…

Q: In ruminants, what is the function of their gut microbes? O Make vitamin D O Digest cellulose O Move…

A: Cellulose is an organic compound or structural polysaccharide of plants and algae. It provides…

Q: The genes encoding the proteins involved in photosynthetis are activated and their mRNAs are made…

A: The transcription is the process of RNA production from DNA template that occurs will in the nucleus…

Q: What do you think will happen if human cells becomes motile?

Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…

A: Air pollution is the contamination of air due to the presence of chemical, physical and biological…

Q: What is an introduction to immunology and immunopathology?

A: The immune system is comprised of various cellular and humoral elements such as T, B-lymphocytes,…

Q: How does the presence of gill slits in all vertebrate embryos support the theory of descent from a…

A: Gill slits are any of the openings or clefts between the gill arches in aquatic vertebrates that…

Q: ECOR1 cuts Plasmid T into 3 pieces. Feeling grumpy at your professor (☹), you decide to take a…

A: Introduction A plasmid is a little extrachromosomal DNA molecule that can replicate independently of…

Q: What would be the consequences to the outcome of meiosis if SPO11 is absent? Explain your reason.

A: Meiosis is a type of cell division that produces four gamete cells by halving the number of…

Q: The anatomy of Pinus needle reflects the features of a- (A) Mesophyte (B) Xerophyte (C) Hydrophyte…

A: Introduction - Pine needles spiral around the stem in a spiral pattern. Each year, as a pine tree…

Q: When a certain body arna manitest an typeromia, increased capilary fitration and sweoling, mis…

A: Introduction Hyperemia is a condition in which there is an excess of blood in the vessels of a body…

Q: ACTIVITY 12 - CARBOHYDRATES As you watch the videos, take notes about what you are learning about…

A: Introduction Sugar molecules are carbohydrate molecules. Carbohydrates are one of three main…

Q: The morphological nature of rhizophore of Selaginella is- (A) Root like (B) Stem like (C) Both root…

A: Introduction - Rhizophore: tufts of adventitious roots near the tip of club mosses of the genus…

Q: Briefly discuss how sickle cell mutation affects the protein.

A: Normal RBC ( Red blood cells are ) are biconcave shaped , and comprises of pigment protein…

Q: General characteristics of protozoans Internal and external structures Feeding…

A: Protozoa are unicellular organisms. They range in size or shape from an amoeba, which could also…

Q: Which is common between aerobic respiration and anaerobic respiration ? (A) Similar substrate (B)…

A: Introduction - Respiration can be divided into two categories: Respiration that occurs in the…

Q: 1. Briefly discuss the folowing; (a) sources of microorganisms in low-heat-processed meat products;…

A: The non-vegetarian food is highly nutritious in nature and has a very high amount of protein…

Q: 10. A fly gene Faf is required for eye development. The human genome has a homologous gene called…

A: Introduction A homologous gene (or homolog) is a gene passed down from a common ancestor in two…

Q: 7) This refers to the pattern being followed by the arrangement of an animal's body parts. 8) This…

A: The organisms are classified into three categories based on symmetry - Assymetric Radially…

Q: MSA/mannitol salt agar plate is selective because: O it allows only gram positive bacteria to grow O…

A: Mannitol salt agar(MSA) It is a selective medium used for the isolation, enumeration and…

Q: The reason why the eudicot trees tend to be wider at the base than at the top.

A: In eudicots, the endosperm is included within the cotyledons and is not separated. The two…

Q: Medium/test Used Negative result Indicators, key regents, or key ingredients Positive result…

A: Dear student as per Bartleby policy i can solve first three parts only. Please post the remaining…

Q: List and describe the 6 stages of phagocytosis.

A: Introduction :- Phagocytosis is a cellular process that involves the ingestion and elimination of…

Q: a. Carbon Cycle i. Producers ii. Consumers iii. Decomposers iv. Methanogenesis

A: Carbon cycle is the biogeochemical cycle by which carbon is exchanged among biosphere, pedosphere,…

Q: How was the first natural antibiotic discovered? (To answer this question, identify the antibiotic,…

A: Antibiotics are antimicrobial substances that are active against microorganisms. It is the most…

Q: . Why doesn't having a gene variant associated with a particular illness or disorder guarantee a…

A: Genes are DNA structures found in chromosomes. The structure of our genes governs how our bodies…

Q: answer 1,2,3,4,5,6,7 and 8. 1. Diphyllobothrium latum 2. Taenia saginata 3. Taenia solium 4.…

A: Answered 1234

Q: How is cystic fibrosis inherited

A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…

Q: The is the foundation of a medical term The comes at the end of a medical term The is attached to…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Polymerase
movement
RNA POLYMERASE
-Nucleotide being added
to the vijend of the RNA
RNA
NTPS
RNA-DNA
hybrid region
32. Refer to the transcription bubble diagram (above) to fill in the blanks.
5'-
3'-
Template strand/Sense strand
Coding strand/Antisense strand
Region of DNA unwinding
Region of DNA rewinding

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.