List the ways in which intact endothelium prevents clotting 6) Know the functions of the coagulation factors & list the factors in the Extrinsic, Intrinsic, & Common pathways.

Q: 1. Explain why egg white and milk are used as antidotes in heavy metal poisoning. 2. Surgical…

A: 1. The egg white and milk are used as antidotes for heavy metal poisoning because the egg white and…

Q: 11. Match the following Sigmoidal curve ✓ Oxygen storage ✓ Contains heme Globular proteins Tetramer…

A: Haemoglobin is a transport protein that can transport oxygen to cells and tissues in the body.…

Q: 10. Can any of the sidechains of the amino acids in oxytocin participate in forming ionic bonds?…

A: Oxytocin is a peptide hormone, composed of 9 amino acids with amino acid sequence CYIQNCPLG. It is…

Q: How can co-enzymes affect enzyme activity?

A: Enzymes are biological catalysts and majorly belongs to the protein class of biological…

Q: ________ is a regulatory mechanism in which the end product of a metabolic pathway inhibits an…

A: Enzymes are biological catalysts. The enzymes, whose ability to catalyze a reaction depends upon…

Q: One sample of the globular protein peroxidase is hydrolyzed by heating with 6 M HC1. A second…

A: Denaturation is the process of loss of native conformation of the proteins. The agents for…

Q: 1. The R group of the amino acid lysine is: -CH2-CH2-CH2-CH2-NH2. Draw the structure of lysine,…

A: Amino Acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…

Q: This question is about "ANSERINE" not just "SERINE

A: Anserine is a dipeptide composed of beta alanine and methyl histidine. It is found in brain of birds…

Q: Compare and contrast the principle behind DNA migration in agarose gel electrophoresis from that of…

A: Electrophoresis is a technique that involves the migration of charged molecules under the influence…

Q: Describe the structural basis for the cooperative (allosteric) binding of O2 by hemoglobin but not…

A: Both hemoglobin and myoglobin are oxygen transport proteins. Both of them are complex proteins…

Q: hat is an ONPG test? WHat is he principle behind this assay.

A: Fermentation of lactose happens by bacteria which depends on two enzymes - permease (allows lactose…

Q: need help to 1）hand draw the dipeptides that contains Glutamic acid and Proline. 2）hand draw the…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…

Q: The starting substrate and active site of a Type I topoisomerase is shown below. During this…

A: Topoisomerases change the topology of DNA by breaking either one or two of the DNA strands and allow…

Q: Which of the amino acids does NOT have an aliphatic side chain?   a.   Lysine   b. Alanine…

A: R groups in aliphatics are nonpolar and hydrophobic. The hydrocarbon chain's hydrophobicity rises as…

Q: 15. A substrate binds to enzyme active site. a) List the roles of serine, histidine and aspartic…

A: The enzyme has serine, histidine and aspartate in the active site.  Serine proteases are protein…

Q: The chromosome of the bacterium (prokaryote) Escherichia coli has a size of approximately 4,000…

A: DNA stands for deoxyribonucleic acid. It carries genetic information useful for development and…

Q: explain in detail (in words) the Krebs cycle in cellular respiration

A: A catabolic process happens inside the cells during cellular respiration. In a biochemical process,…

Q: What type of enzyme regulation is the most readily (quickly) reversible?

A: Enzymes are biocatalysts that catalyse the biochemical reaction. Substrate molecules bind to the…

Q: Energy is stored long-term in the bonds of _____ and used short-term to perform work from a(n)…

A: A molecule is defined in chemistry as a grouping of distinct atoms. Water molecules (H2O) and carbon…

Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…

A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…

Q: In order to study protein structures and functions, many protein techniques have been developed for…

A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…

Q: A one-to-one protein (P)-ligand (L) complexation (P + L PL) has a equilibrium constant (Kd) value…

A: ∆Cp is the heat capacity at constant pressure. ∆S is change in entropy, degree of randomness. At…

Q: Regarding the physical condition (characteristics of the solution/environment) in which an enzyme…

A: Enzymes are large molecular weight proteins that catalyse biochemical reaction.  An enzyme's…

Q: HO 0 0 NH₂ НО.

A: The fundamental building blocks of proteins are called amino acids, which are made up of one…

Q: 35. What is the approximate pl for the peptide MEKVDRP. Because this is a peptide, assume the pka…

A: Peptide : Peptides are short or small chains of amino acids having about 2-50 amoino acids. As amino…

Q: The phospholipids in the outer leaflet of the plasma membrane of a human cell are fluorescently…

A: The plasma membrane of an animal cell is majorly composed of phospholipids. The phospholipids form a…

Q: What is the product of the oxidation of this fatty acid?

A: The aerobic fatty acid oxidation mechanism in the mitochondria converts a fatty acid into acetyl-CoA…

Q: Need help, please.

A: Malate dehydrogenase is an enzyme that catalyzes the final reaction of the TCA cycle. In the first…

Q: Identify basic structure of the 8 types of membrane proteins shown below Understand how primary…

A: According to the fluid mosaic model of the plasma membrane is a phospholipid bilayer that has…

Q: Select the answer with an INCORRECT statement about the hydrophobic effect It is important for…

A: Hydrophobic effect is the tendency of non polar molecules to interact with each other in polar…

Q: ΔG° indicates the change in the standard free energy as a reactant is converted to product. Given…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…

Q: 1. Why does nitric acid stain the skin yellow? 2. How does the Xanthoproteic test differ from the…

A: Nitric Acid :  It is a nitrogen oxoacid having a formula HNO3 , in which  the nitrogen atom is…

Q: True or False: Phosphoryl groups are added to enzymes to increase their activity. *If this…

A: The enzymes are biological catalysts that are mostly protein in nature. The activity of an enzyme…

Q: : how  does Aβ affects our body?

A:

Q: a.       The importance of recombinant DNA technology in Environment  b.       Potential products…

A: DNA : Deoxyribo nucleic acid. It is a polymer which is composed of two polynucleotide chains that…

Q: The side chain of which residue can be hydrogen bond donor:   a. Thr b. Ala c. Ile d. Pro e.…

A: There are twenty standard amino acids that differ from each other on the basis of their side-chain…

Q: Which of the following statement about the enzyme thermodynamics is TRUE?   a. Enzymes increase…

A: Introduction Enzymes are known as bio-catalyst. All the metabolic reaction of our body is enzyme…

Q: What possible quiestions can be askeed under the following question: How can one inestigate the tyoe…

A: AZT is a anti-HIV drug. It is a nucleoside analogue. AZT is incorporated in the replicating DNA in…

Q: A.We have seen from history the role science has played in the prevention and control of diseases.…

A: Epidemiology : It is the study of diseases in a population, studying the reason , how it spread, why…

Q: In the table below, name each functional group in anserine that is ionizable and record an estimated…

A: Serine is an amino acid with molecular formula C3H7NO3. Its molecular weight is 105.09 g/mol. Serine…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Increased NADH concentrations in the liver encourage gluconeogenesis. What do you think about this…

A: Gluconeogenesis is glycolysis run backwards with three new enzymatically catalysed reactions where…

Q: Calculate the approximate concentration of the uncharged form of alanine (see below) in a 0.01M…

A: Recall that: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch…

Q: You have discovered a new species of plant. You isolate chromatin from the plant and examines it…

A: Histones are basic proteins that are rich in basic amino acids like arginine and lysine. These basic…

Q: An allosterically regulated enzyme in the R state is unable to bind substrate at the active site.…

A: Allosteric site : It is a place or site on an enzyme where the molecule which is not a substrate can…

Q: A) Write out both strands of the recognition sequences for BamHI and Sau3A, show what they would…

A:

Q: Arginine has three ionizable groups. The pK of α-COOH is 2.18; α-NH 3 + , 9.09; and the R-group,…

A: Isoelectric point (pI) is the pH at which the net electric charge of the amino acid is zero. When,…

Q: Please answer fast draw pyruvate carboxylase mechanism. cofsctors must include. label all…

A: Pyruvate carboxylase is an enzyme which catalyzes the conversion of pyruvate to carboxylase.…

Q: what is the concetration of a lysozyme  solution  with an absorbance of  0.720 measured at 280 nm(…

A: Measuring the concentration of a substance in solution on the basis of its absorbance forms the…

Q: Sucrose is a disaccharide composed of rich of the following monosaccharides? Group of answer…

A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.