Question 1: The restriction enzyme Sau3A recognizes the sequence 5'-/GATC-3' and cleaves on the 5'side of the G as indicated by the slash. Since the top and bottom strands of this restriction site areidentical in the 5'-3' direction, only one strand of the site needs to be shown. The single-stranded endsproduced by Sau3A cleavage are identical to those produced by BamHI, which recognizes the sequence5'-G/GATCC-3' and cuts at the location of the slash. This means that an end cut by one enzyme can beligated onto an end cut by the other enzyme by DNA Ligase. Given this information, answer thefollowing questions:A) Write out both strands of the recognition sequences for BamHI and Sau3A, show what theywould look like after they are cut, and what the DNA would look like after you ligate a BamHI site to aSau3A site. Make sure that it is easy to follow the individual pieces of DNA. You may want to use twodifferent colors to keep them separate.B) What fraction of BamHI sites can be cut by Sau3A? What fraction of Sau3A site can be cutby BamHI?C) If two BamHI sites are ligated together, the resulting site can be cleaved again by BamHI.The same is true of two Sau3A ends. Suppose you ligate a fragment with a Sau3A end into a plasmidthat has been cut by BamHI, can the hybrid site be cut with BamHI? Can it be cut with Sau3A?D) Restriction enzyme recognition sites occur randomly throughout the genome. Calculate theprobability of a Sau3A site (each nucleotide has 4 possibilities and in statistics the probability ofmultiple events is the probability of one multiplied by the probability of the other). Is that greater orless than the probability of a BamHI site? What is the probability of a BamHI site?

Restriction enzymes (RE) are endonucleases group of enzymes which cleaves at the sequence specific…

Answered: A) Write out both strands of the…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
Question 12 What is the purpose of the inverted repeats at the ends of DNA-based transposons? A. The inverted repeats are recognized by restriction enzymes that cut out the transposon B. The inverted repeats are magnets for nucleases C. The inverted repeats are the sites of transfer on the target RNA D. The inverted repeats are recognized and cut by transposase to move the transposon from its original location
QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…
Question 2: Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown) Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown) Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…
QUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteins
QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…
QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…
Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences
QUESTION 48 Identify the best match between the mutation description and term. a. Synonymous mutation: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts b. Nonsense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence c. Indel: a change in the DNA that changes the codon code from one amino acid to another amino acid d. Missense mutation: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine but does not change the amino acid sequence
QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase Telomerase
QUESTION 22 The DNA sequences that are most conserved between human and mouse would most likely be located in: A Highly-repeated sequences, such as microsatellite regions B Highly repeated sequences, such as Alu sequences C Moderately-repeated non-coding sequences D Coding regions of single-copy genes

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS