Mang Isko has one hectare corn production with high-value vegetable near in it.  He wanted to apply herbicide in his weed-infested corn through spraying. Is his decision effective? What do you suggest pest control? Give at least 4 sentences.

Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…

A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…

Q: ou volunteer at a hospital where a patient complains that her bones feel weak. She has broken her…

A: A patient with weak bones and several hip fractures and inability to eat diary products.

Q: Which of the following statements best explains why there are many more codons than there are amino…

A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…

Q: We can determine the expected number of DCO individuals among the progeny of a trihybrid cross by:…

A: When chromosome fragments are exchanged in two sites, it is called a double crossing. The two ends…

Q: Which of the following types of neurons are indicated by asterisks in the photograph of a cross…

A: The nervous system is the most vital system in the human body. It comprises of the neurons which are…

Q: 19. A 22-year-old man who was recently diagnosed with type 1 diabetes mellitus has learned to test…

A: Diabetes 1 is a chronic disorder. Due to this disorder the patient pancreas produces little or no…

Q: Describe the animal Aye-Aye’s heart,Accessory organs,mouth/nose,trachea,and lungs

A: Organ system Organ Human Pig Aye-Aye Digestive Mouth the buccal cavity contains many boiled starch…

Q: To describe the six main taxonomic groups of fungi and also explain the reason that some fungal…

A: As per our company guideline we are supposed to answer only first question. Kindly repost other…

Q: Research how the concepts and techniques in molecular biology are applied in disease diagnosis and…

A: The concept and techniques of molecular biology involves genetic engineering which means the…

Q: List processes Microorganisms are involved in (ex., oxygen production)

A: All the organisms which performs the process of Photosynthesis can produce oxygen. Microorganisms…

Q: To explain: The evolutionary changes in the plant reproduction that are adapted by plants to…

A: The change of a species' defining feature over numerous generations is referred to as evolution,…

Q: Below are DNA strands. Make the complementary DNA strand: Original Strand: 5’ A T G C A A A T T G C…

A: Deoxyribonucleic acid or DNA is the molecule that carries genetic information for the development…

Q: The oxygen species found in the respiratory burst are contained to inside a neutrophil. O True False

A: Respiratory burst is the production of large number of oxygen species when phagocytosis of microbes…

Q: diagnosis "Infectious-allergic A 30-year-old patient is hospitalized with the myocarditis". The…

A: Heart is a major blood pumping organ. Heart is covered with three layers - the outer epicardium, the…

Q: Does reclassification of a dinosaur, or any other species, decrease the supporting evidence for the…

A: Evolution is the process of formation of life on the earth in the form that we see today. It is a…

Q: Plant-based foods such as fresh fruits, vegetables, legumes, and whole grains and vegetarian eating…

A: d all of these  Plant based diet can improve gut health in about 5  days . Legumes , Vegetables are…

Q: Using the following word parts, build or complete medical terms from the definitions hem/o hyper-…

A: Using the following word parts, build or complete medical terms from the definitions below: Prefix…

Q: Compare and contrast stabilizing, directional and disruptive selection with regard to how each…

A: Introduction  Natural selection is the adaptation and modification of populations of living…

Q: Please answer fast Suggest how the weak points of the molisch test for carbohydrates can be…

A: Introduction :- When concentrated hydrochloric or sulphuric acid is added to Molisch's test, the…

Q: what major demographic trend will most impact the delivery of health education/promotion in the next…

A: Introduction  Health education is a field that focuses on informing people about their health.…

Q: 10. Which of the following letters on the electron micrograph of a nerve represents a Schwann cell…

A: Introduction  Myelin is a lipid-rich membrane that surrounds nerve cell axons to insulate them and…

Q: Label the 48 hr chicken emrbyo

A: Embryo It is a product of fertilization that results from the fusion of an egg and a sperm. The…

Q: From an evolutionary point of view, why can't we say that the human species is the most evolved?…

A: Evolution is the gradual modification of life forms through a period of time. This process takes…

Q: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…

A: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…

Q: Why its important in biomechancs field, Internal Fixation and External Fixators of Bone Fracture..…

A: External fixation is a surgical treatment used to set bone fractures in which a cast would not allow…

Q: Q1- The kidneys sit in the back of abdomen O TO 4 and to13 OTO3 And To12 O To 3 and To11

A: The kidneys are two bean-shaped organs, each about the size of a fist. They are located just below…

Q: Selective destruction of a motoneurons in the spinal cord will have which of the following effects…

A: Introduction Muscles are soft tissues found in both animals and humans, it is the fibrous tissue in…

Q: 35, 34 33. 36 32 38. 37. 31- 30- 39. 40, 29 28 27 26 25 45 43 44 24 23 46 L 22 21 2 20 W 6 18. 16 17…

A: The 72 hours chicken embryo contains a bigger embryonic area and four flexures. It contains a…

Q: To determine: The features of a fungus's body structure that is related to its method of acquiring…

A: Organisms that are neither plants nor animals are classified as fungi. Yeasts, moulds, and mushrooms…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Define each in two short sentences Allopatric speciation Sympatric speciation Adaptive radiation…

A: Evolutionary biology is a branch of biology which explores the mechanisms that led to the variety of…

Q: Fats, cholesterol and waxes are examples of which type of biomolecules? * A. Carbohydrates B.…

A: Biomolecules are chemical compounds found in living organisms. These include carbohydrates, lipids,…

Q: The membrane voltage in graded potentials can be produced by open channels and ligand-gated chanels…

A: Graded potentials are the type of action potentials that make the membrane potential more negative.…

Q: Name five functional traits of microorganisms. What dose the functional diversity describe? Do we…

A: Functional traits of the microbes describe individually expressed phenotypes or characteristics of…

Q: S1 heart sounds (“lub”) represent the closing of the

A: Heart is the main pumping orgen of circulatory system and vital organ of body. Contraction and…

Q: How do HIV criminalization laws conflict with the medical evidence on how HIV is spread. In the…

A: The human immunodeficiency virus (HIV) is an infection that targets the immune system, primarily CD4…

Q: why is RNA important in a physiology standpoint, and why is it important to know about this for…

A: RNA is Ribose nucleic acid. Its main building block is a nucleotide which is made up of a ribose…

Q: Explain structural adaptations necessary for the invasion of dry plants and also state which…

A: To survive against the drought conditions various plants undergo structural modifications. Some of…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: Lab was on the translation process from mRNA to amino acid, post-translational modification of…

A: Introduction  Protein biosynthesis is an important biological process that takes place inside cells…

Q: The term alteration of generations, which two generations are involved and the way of reproduction.

A: alternation of generations,  it is the process by which plant perform two mode of life cycle sexual…

Q: What is Asexual reproduction? Explain kindly

A: Asexual reproduction: What is it?Asexual reproduction refers to a type of reproduction where a child…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: Answer whether the following statement is True or False: Diameter of nascent polypeptide exit tunnel…

A: Introduction: Peptide bonds are formed when amino acids are condensed to form protein structures. A…

Q: A)Identify the bone B)What is the name given to area the arrow points to. C) Name one joint this…

A: The arms are the part of the skeleton, which include the bones of upper arm, firearm, wrist joints,…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: The mutations are changes in the DNA sequence. The mutations can substitute, add or delete a portion…

Q: Salmonella Typhi Who discovered it? When was it discovered? How was it discovered?  Kindly answer…

A: Salmonella enterica typhi is a gram-negative bacterium that is responsible for typhoid fever.

Q: 85. A 16-month-old boy is brought to the office by his 18-year-old mother for a well-child visit.…

A: The time taken by a toddler to learn and  perform toilet by himself can greatly differ. The age of…

Q: 3.2. From an anatomical point of view, plants undergo cell differentiation. Zinnia elegans is an…

A: All cells are derived from apical meristems or region of cell division includes the apical meristem…

Q: 65. Which of the following fibers provides the only output of the cerebellar cortex? A) Climbing…

A: Purkinje cells are the most striking histological feature present in the cerebellum. Dendrites…

Environmental effects

Environmental effect is the beneficial or adverse impact of human products, services, or activities on the environment. For example, the release of volatile organic compounds negatively affects the environment and causes smog formation. On the other hand, collecting litter and putting it in bins positively affects the environment.