Match the mutation in the trpl. leader sequence with the correct phenotype of the mutant. O Region 2 of the TrpL. is mutated, such that it cannot pair with A. attentuation will always occur region 3 O Region 3 of the Trpl. is mutated, such that it cannot pair with C. The TrpE, D,C, B, and A open reading frames will not be B. The TRP repressor will bind to the operator region 4 translated because of a nonsense mutation O Region 1 of the TrpL. is mutated, such that it cannot pair with D. attentuation will never occur region 2 E. The TRP repressor will not bind to the operator * The two TRP codons in the TrpL sequence are mutated from UGG to UGA.

Match the mutation in the trpl. leader sequence with the correct phenotype of the mutant. O Region 2 of the TrpL. is mutated, such that it cannot pair with A. attentuation will always occur region 3 O Region 3 of the Trpl. is mutated, such that it cannot pair with C. The TrpE, D,C, B, and A open reading frames will not be B. The TRP repressor will bind to the operator region 4 translated because of a nonsense mutation O Region 1 of the TrpL. is mutated, such that it cannot pair with D. attentuation will never occur region 2 E. The TRP repressor will not bind to the operator * The two TRP codons in the TrpL sequence are mutated from UGG to UGA.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 4CT: The photos below show flowers from two Arabidopsis plants. One plant is wild-type unmutated; the...

See similar textbooks

Similar questions

Mutations in the promoter region of the β-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box), transcription usually A. increases b. stays about the same c. decreases
The “domain-swapping” experiment that grafts the Gal4 DNA-binding domain to the LexA activation domain generates a chimeric protein that will: A) bind to the Gal4 site. B) bindto the LexA site. C) activate transcription of the LexA gene. D) activate transcription of alleukaryotic genes. E) All of the answer options are correct.
Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change B. some, but not all , mRNA codons change C. there is no change in mRNA codons D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? * A. Cys-Phe B. Tyr-Tyr C. Phe-Leu D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? * A. Thr-His B. Thr-Thr C. His- Ile D. Ile- Asp Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids…
My Avya mouse is brownish because a) the CpG island with the transposon is unmethylated. b) it was feed an unsupplemented diet. c) transposon has enabled agouti gene expression. d) none of the above.
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
What type of mutation causes the "mutant" variety of the PTC gene? a A point mutation which lead to a nonsense mutation b A addition mutation which lead to a frameshift c A substitution mutation which lead to a missense mutation d A deletion mutation which lead to a SNP mutation
Mutation of which of these sequences would have an effect on translational initiation? A. 3’ UTR B. Polyadenylation signal C. 5’ UTR D. upstream enhancer E. TATA box
A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type phenotype. At the DNA level, this typeof mutation can be an exact reversion or an equivalent reversion. An equivalent reversion produces a protein that is equivalent to thewild-type protein in structure and function. This outcome canoccur in two ways. In some cases, the reversion produces thewild-type amino acid (in this case, glutamic acid), but it uses adifferent codon than the wild-type gene. Alternatively, an equivalentreversion may substitute an amino acid structurally similarto the wild-type amino acid. In our example, an equivalent reversionhas changed valine to an aspartic acid. Because aspartic andglutamic acids are structurally similar—they are acidic aminoacids—this type of reversion can restore wild-type structure andfunction.Here is the question: The template strand within the codingsequence of a gene has the following sequence:3′–TACCCCTTCGACCCCGGA–5′This template produces the…
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The photos below show flowers from two Arabidopsis plants. One plant is wild-type unmutated; the other carries a mutation in one of its ABC floral identity genes. This mutation causes sepals and petals to form instead of stamens and carpels. Refer to Figure 10.7 to decide which gene A, B, or C has been inactivated by the mutation.
You are studying a new gene that is expressed within the adipose tissue of humans during the development of diabetes. Specifically, you want to learn why gene expression levels are very high in those people who develop diabetes. What DNA sequence would you concentrate on? Group of answer choices A specific response elements B the TATA box C enhancer sequences D promoter proximal elements E metal response elements
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved