Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class III) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants will grow on complete media?

Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class III) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants will grow on complete media?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?
In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.
Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein? Why or why not?
A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?
The pathway for arginine biosynthesis in Neurosporacrassa involves several enzymes that produce a seriesof intermediates.ARG-E ARG-F ARG-G ARG-HN-acetylornithine → ornithine → citrulline → argininosuccinate → argininea. If you did a cross between ARG-E− and ARG-H−Neurospora strains, what would be the distributionof Arg+ and Arg− spores within parental ditype andnonparental ditype asci? Give the spore types inthe order in which they would appear in the ascus.b. For each of the spores in your answer to part (a),what nutrients could you supply in the media to getspore growth?
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?
In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . . . incorporates glutamine, asparagine, and threonine. What triplet code can definitely be assigned to threonine?
A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?
The following RNA polymer is added to an E. coli extract, where it can be translated in all three possible reading frames. Which amino acids can be polymerized into polypeptides in this system? 5'-AUAUAUAUAUAUAUAUAUAUAUAUAUAU-3'
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?