Q: What is the ratio of the possible phenotypes of the offspring when you cross the cats in the image
A: Inheritance is the foundation upon which heredity is built. It is described as the process through…
Q: Choose the mismatch: Feature a. Bilateral symmetry b. First triploblastic c. free-living flatworm d.…
A: The eukaryotic multicellular organisms that belong to the biological kingdom Animalia are referred…
Q: "apoA, apo(a), apoB, apoC and apoE" "apoA, apoB, apoC, apo E, and apol" O "apoB, apoC, apoD, apoE…
A: apolipoproteins are the proteins that bind lipids. These lipids could be in the form of cholesterol…
Q: Q2: Incomplete reduction of oxygen to water in ETC produces reactive oxygen species (ROS), - Write…
A: Macrophages perform critical roles in the start and resolution of inflammation, primarily by…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A:
Q: B. Consider the following types of cells and their respective conditions: i. a liver cell with…
A: Depending on the availability of oxygen, there are two types of respiration. Aerobic respiration…
Q: a. Explain how figures 3 and 5 are connected. Does this support the hypothesis proposed by Parent…
A: Resistance Resistance is defined as the ability of an organism to avoid the attack of a compound or…
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Question 1 Lipids from an organic sample are extracted separately using acetone (A), hexane (H), and…
A: The KHSO4 test is known as acrolein test and is used for fat or glycerol detection. Hexane extract…
Q: 12 10 00 (log) Number of species 6 A N 0 400 800 1200 Age of clade (My) Use the information in…
A: It is a study conducted by Rabosky and as per the report the answer is given: As per the provided…
Q: Examine the graph below and answer the questions provided: (a) At what point of this graph is…
A: The action potential curve in the nerve is given in the image. The graph is present between the…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: Blood pressure is measured with a sphygmomanometer. Average normal blood pressure of an adult is…
Q: Which of the following is not a characteristic of plant hormones? They are active in small…
A: Plant hormones like Auxin, Cytokinin, etc. are produced at extremely low concentrations. At very…
Q: In Brinjal eggplants, purple fruit is incompletely dominant to white fruit, with the heterozygote…
A: When a white flowering plant is about to make a cross with a purple flowering plant, the resultant…
Q: Question 9 Why are integral membrane proteins difficult to study? O They are difficult to isolate in…
A: Integral membrane proteins Proteins which are permanently bound to the lipid bilayer. They require…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…
A: The bond between nitrogen and alpha carbon (N-Calpha) in amino acid is known as phi bond. On the…
Q: How can a UV-Vis spectrophotometer be applicable in determining the absorbance/concentration of a…
A: UV and visible radiation are only a small part of the electromagnetic spectrum, which also includes…
Q: (Heart) Which interval is the longest: a. between beginning 1st sound and end of 2nd sound? b.…
A: Heart echocardiography is quickly becoming a routine treatment technique for a wide range of cardiac…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: The heart is a muscular organ the size of a fist that sits directly behind and somewhat to the left…
Q: Match the description on the left with the correct term on the right. Some answers may not be used.…
A: Match the correct term on the right to the correct description on the left.
Q: 13) when testing the ability of a frog’s skeletal leg muscle to move, which chemical would be best?…
A: Neurotransmitters are chemicals that are responsible for transmitting signals between nerve cells,…
Q: iv) The phenotype of a double mutant, W X, is shown below. Choose the single regulatory scheme above…
A: The fundamental method to understand the process of gene expression in eukaryotes is to examine…
Q: II. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize…
A: ATP synthase This enzyme is used in the process of oxidative phosphorylation to generate ATP…
Q: 35) how epinephrine can have a depolarizing effect on one tissue and a hyperpolarizing effect on…
A: Hormones are chemical substances produced by our body's endocrine system, which releases the…
Q: Which of the following does not describe Linkia sp.? A. Ventral side is lined with two rows of tube…
A: Linckia is a genus of star fish or sea stars which are of different colors and shapes. They are…
Q: Question 31 What directly or indirectly determines the transition temperature? O the ability of…
A: Biomolecules are the fundamental building components of all living things. They play an essential…
Q: select a microbe that has proven to be either environmentally or socially beneficial to human…
A: In this question we have to describe about the useful bacteria . See full answer in step 2.
Q: acid base balance
A: Acid is a substance that is capable of donating protons. Base is a substance that accepts the…
Q: The following image shows Nondisjunction. Which of the following cells will suffer from a genetic…
A: Nondisjunction is a failure of chromosomes to separate during cell division. This results in the…
Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…
A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…
Q: 1. 2. 3. 4. Name (1) (2)
A: The female reproductive system includes the ovaries, Fallopian tubes, uterus, vagina, accessory…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: The next two questions go together. Again with the llamas that display an extraordinary range of fur…
A: In this question we have to discuss about a type of epistasis. See detailed answer in step 2.
Q: How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and…
A: Threats to biodiversity as a example if we take oil spillage during crude oil extraction that used…
Q: 3. Which side of the heart pumps oxygenated blood to the body a. Left side b. Right side
A: The heart is the organ which pumps the blood to the body. The heart is the link between the lungs…
Q: Carnivorous plants: CARNIVOROUS PLANTS Carnivorous plants attract insects promising a reward of…
A: Answer :-(D) is correct.
Q: Question 4 In ducks, the allele for black feathers (B) is co-dominant with the allele for white…
A: Alleles Alleles are the two different varieties of same gene for example height is gene and long and…
Q: The amount and composition of dietary fat are important factors for influencing blood lipid…
A: Dietary fiber can help reduce blood cholesterol levels by: binding cholesterol and bile acids in…
Q: Q7. Why are Okazaki fragments formed in DNA replication?
A: The first question is answered as per the guidelines. Please put a separate question for the other…
Q: Label the columnar epithelium, reticular fibers, smooth muscle, and loose CTP of the small intestine…
A: in this question We have to describe about histology of small intestine. Sea full answer in I am…
Q: A. What is paroxysm? Describe the stages of paroxysm.
A: In this question we have to describe about paroxysm. See detailed answer in step 2.
Q: What part of the organism is used in order for it to maintain its position in its natural…
A: Introduction Crustacea:- They are any of a large group of mostly water animals with a body made of…
Q: Cancer stem cells
A: Cancer stem cells (CSC) represent malignant cell subsets in hierarchically organized tumors, which…
Q: Genetic engineering applied for generating food sources is said to be different from traditional…
A: Introduction:- By modifying the genetic composition of crops, genetic engineering and traditional…
Q: 3 advantages and disadvantages of conventional breeding.
A: Conventional breeding: Also called as classical breeding or traditional breeding. Using this method…
Q: In rabbits, short hair (S) is dominant over lang hair (s). What genotype and phenotype ratios are…
A: The cross is between two heterozygous short haired rabbits. Here s is Dominant ove S. So, Ss × Ss…
Q: 100 g www.L Larvae and pupae per Bt plant T 60 0 h J TOH -- Mosaic, Cry1Ac plant --0-- Mosaic, Cry1C…
A: Bt plant Bt plant is abbreviated for Bacillus Thuringiensis plants. These are transgenic plants…
Q: USING THE RAINFOREST get data for the following. Dominant plant and animal species Keystone…
A: Location and species found in rainforest.
Q: What is the difference between diffusion and facilitated diffusion?
A: Diffusion is a process by which particles move from higher concentrations to lower concentrations.…
Step by step
Solved in 2 steps
- Please include your reference below for my further research. Thank you! 1. What are the basic components of a Fluorescence Microscope and what are the functions of each? 2. Are there any parts that you can remove without compromising accuracy and utility of the equipment? 3. Can you suggest additional components to improve the equipment?Please answer the following questions (Question 1 AND 2) about compound microscopes. After clicking the objective into position, which adjustment knob(s) can you use to safely refocus the image? You may need to adjust the light intensity to better see the specimen. Indicate two ways in which you can change the light intensity?Can someone answer and explain the following? What are the basic components of a Fluorescence Microscope and what are the functions of each? Are there any parts that you can remove without compromising accuracy and utility of the equipment? Can you suggest additional components to improve the equipment?
- A lab revolving around compound microscopes was conducted. Please answer the following questions (questions 1, 2, and 3). If a specimen (placed on a slide) has little or no color, what level of light intensity should you use; should the intenisty of the light be high or low (choose)? Which objective should be in position before you start to focus the microscope? Which focus knob should you use first with this objective?answer the following: instruction.match the name of the major part (listed below) with its location on the microscope, and give a very brief description of what each is used for:How can a UV-Vis spectrophotometer be applicable in determining the absorbance/concentration of a colorless sample? Please answer in detail and clearly. Thank you so much!
- Previous question: For example, you can estimate the field of view diameter at 400x total magnification using the measured diameter at 100x total magnification. The magnification is 4 times greater so the field of view will be 4 times smaller. What is the field of view under the 40X objective of the microscope. - The Answer I got for this question was 3/4mm.Previous question: The field of view is the maximum area visible through the lenses of a microscope, and it is represented by a diameter. To determine the diameter of your field of view, you can place a transparent metric ruler under the low power (10X) objective of a microscope. You would focus the microscope on the scale of the ruler and measure the diameter of the field of vision in millimeters. Refer to the image taken of this preparation below. What is the approximate field of view as seen by this 10X objective. Note: This microscope has a 10X eyepiece, giving a total magnification of 100X. The image shows the 1mm is for this question. - Answer for this question was 3mm.please solve question Q1: According to the figure answer the following questions ( B 1. What is the letter which represent Revolving nosepiece 2. What is the letter which represent Coarse adjustment knob 3. What is the letter which represents the part that magnify the image 40 X 4. What is the letter which represents the source of illumination 5. what is the type of the above microscope?
- Hello, I need help determining the FOV for the objective microscope, ocular lens please.List down 5 steps in the given procedure below for the proper use of microscope that you think emphasized on proper equipment care and briefly explain why you think so in 1-2 sentences per identified step. 1. Connect the microscope to the power supply. Turn “ON” the microscope.2. Rotate the light intensity adjustment knob to adjust the brightness.3. Place the slide with the specimen facing upwards on top of the mechanical stage. a. Open the bow-shaped lever of the stage clip outward.b. Slide the specimen from the front toward the rear.c. Return the bow-shaped lever gently.d. Center the specimen over the aperture on the stage. 4. Use the Low Power Objective. a. Rotate the revolving nosepiece until the 10x objective lens is “clicked” into position.b. Rotate the condenser focus knob to bring the condenser down to the bottom and partially open the iris diaphragm.c. Rotate the coarse adjustment knob to focus the image. Move it as far as it will go without touching the slide.d. When coarse…How does the compound microscope achieve magnification? resolution? Cite your reference/s if possible.