mitosis

Q: What is the complementary sequence of the given nucleic acid sequence? (write your answer in the 5'-...

A:  the complementary sequence of given nucleotide is :-  TGACCAGTCCGAATGCATCAG

Q: iscuss the importance of membrane for the cells, what are the membrane functions?

A: The cell membrane, also known as the plasma membrane, is a thin membrane that surrounds every live c...

Q: 170. The nucleotides within DNA are composed of a  A.phosphate group, deoxyribose sugar, and nitroge...

A: DNA is a molecule made up of two polynucleotide chains that coil around each other to create a doubl...

Q: Look up and list the size of the following proteins; then predict in what order they would be eluted...

A: Introduction Size-exclusion chromatography, also known as molecular sieve chromatography, is a chrom...

Q: Which of the following make up a nucleoside? A base + sugar B base + phosphate c) phosphate + sugar ...

A: Nucleic acids such as DNA and RNA are polymers which are formed by the monomer units called nucleoti...

Q: How did Peyton Rous prove that transmission of the tumor was through a virus?

A: By connecting with host proteins, growing while the human immune system is weakened, and hijacking p...

Q: Question 4 What are the cellular activities that help describe "expression of genetic information"? ...

A: The Central Dogma of molecular Biology involves gene expression. Genes are the functional part of th...

Q: Question 8 If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side...

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each othe...

Q: What is the specific use of biotechnology in beer?

A: Traditional biotechnology the involves use of natural microorganisms to create or modify food or oth...

Q: Last Universal Common Ancestor (LUCA

A: Around 4 billion years age there lived a microbe called LUCA.

Q: A student has a compound microscope equipped with 10X ocular lenses and 4X, 10X, 40X and 100X object...

A: Size of Object= 100 micron = 10 X 10-3 mm= 10-2 mm= 0.01 mm Size of Image= 10 mm Magnification= Size...

Q: Which of the following is NOT an importance of mitosis? a.It facilitates growth of single fertilize...

A: The fundamental and active biological process by which a parent cell, after replication of its compo...

Q: Question 12 Which of the following statements is true of double stranded DNA? The double stranded st...

A: The nucleic acids are one of the major macromolecules found in the body. The others are carbohydrate...

Q: Which of the following is "unfixed" carbon? O N2 (atmospheric nitrogen) O CO2 (carbon dioxide) O C6H...

A: Introduction :- Biological carbon fixation, also known as carbon assimilation, is the process by whi...

Q: Define heterozygous

A: Zygosity it is the degree to which both copies of chromosomes or gene have same genetic material. In...

Q: Which of the following factors maintain grassland biome? a. Natural fire b. High precipitation level...

A: Introduction Grassland biomes are made up of broad open grassy areas. Trees can be found, however th...

Q: With examples, describe how motor proteins move cell parts.

A: Proteins are an integral part of the cells. Various roles are played by the proteins in the human bo...

Q: What is pH (power of hydrogen) and how does it relate to a pH scale?

A: pH stands for the potential of hydrogen or power of hydrogen. It refers to the concentration of hydr...

Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C) ...

A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of ...

Q: QUESTION 8 In the Results section of the paper, the authors' write: "Previous publications have show...

A: As the cancer cell have the ability to provide own growth factor (EGF) and binds with its own recept...

Q: Beginning with 10 grams of plant tissue, order the following procedures (as steps 1-4) that you will...

A: Plant tissue is a cluster of related cells that work together to fulfil a specific purpose for the p...

Q: What role can the pappus play in seed dispersal?

A: Seed dispersal is the movement, spread, or transfer of seeds away from the originating plant. Plants...

Q: Which of the following statements about natural selection is a misconception? a.Most species don't ...

A: Charles Darwin, in 1859, introduced the concept of Natural Selection in his book, The Origin Of Spec...

Q: What happens in logistic population growth whenr>3.7? O a. Population size goes to 0. O b. Populatio...

A: Introduction: A growth curve is an empirical representation of a quantity's evolution through time. ...

Q: Capillaria philippinensis Nematoda Trematoda Sarcodina Dipylidium caninum Congenital Paralysism Para...

A: Parasites --Introduction --Parasites are living organisms that depend on the living host for their s...

Q: Explain the Nucleotide Excision Repair ?

A: DNA and RNA stand for deoxyribonucleic acid and ribonucleic acids. Both molecules are present in the...

Q: LYMPHATIC AND IMMUNE SYSTESMS TRANSCRIPTION EXERCISE Instructions: You are involved in the following...

A: Given: A conversation is given in two paragraphs.The given conversation is related to lymphatic and ...

Q: Where do you expect genetic differences between cells to arise, from mitosis or from meiosis? Why?

A: INTRODUCTION Mitosis This is a process by which a cell divides to form two identical daughter cells....

Q: Oxygen requirements Mycobacterium tuberculosis . Is it a facultative anaerobe, an obligate aerobe, a...

A: Mycobacterium tuberculosis is an obligate aerobe bacteria which requires oxygen for its metabolism. ...

Q: IS opulation?

A: A population is a subgroup of individuals from a single species that inhabit a specific geographic a...

Q: B- True or False: 1) Genes consist of DNA which belongs to the class of nucleic acids 2) The process...

A: Introduction Macromolecules are big, complex molecules that exist colloidally in intercellular fluid...

Q: A mutation that changes an alanine to a leucine in the nucleus of a protein leads to a less active o...

A: Introduction When a DNA gene is destroyed or altered in such a way that the genetic message carried ...

Q: Populations that have reduced variation in their vital rates in response to increasing environmental...

A: Food supply, rivalry for other resources, predation, sickness, or some other environmental issue ult...

Q: Ô https://app.tophat.com/e/719509/assigned 01-12319/12320 Gen Bio - Spring 2022 ode: 719509 ROOM ASS...

A: The Tonicity is a measure of the effective osmotic pressure gradient; the water potential of two sol...

Q: Which of the following is not a component of a nucleotide? a base a disaccharide a phosphate a monos...

A: Nucleotide is the monomer of the nucleic acids.Nucleic acids are  a macromolecule that plays very im...

Q: What is the importance of recombinant DNA to the society todav?

A: Recombinant DNA is a kind of DNA that has been created in a lab. It's made by transplanting certain ...

Q: Why does mitosis and binary fission not always lead to exact copies the parent?

A: ANSWER;- Mitosis and binary fission produce clones that are the exact copy of the mother cell. Mitos...

Q: Q3. What viruses would you predict that could produce mutations in the host genome following infecti...

A: Answer 3)  Negative Single-stranded RNA viruses.

Q: Which of the following is true of thymine and uracil? A Thymine has a methyl group at C-5 and Uracil...

A: Answer : Option D is correct - thymine has methyl group but uracil doesn't have it.

Q: Cell growth and division occurin a regular cycle. This cycle is divided into four phases: G1, S, G2,...

A: Most growth: Blue: Interphase DNA Replication: Red : S phase Preparation of Mitosis : Yellow: G2  

Q: Which of the following are associated with a highly active Glycogen Phosphorylase pathway?

A: Glycogen phosphrylase is an enzyme which undertakes phosphoroclastic cleavage into glycogen, thus pr...

Q: 3. A patient has glucose-6-phosphate dehydrogenase deficiency. Why are red blood cells lysed while o...

A: Glucose-6-Phosphate Dehydrogenase Deficiency:  G6PDD (glucose-6-phosphate dehydrogenase deficiency) ...

Q: 3. Proteins: a. Function depends on the structure b. Monomers are the nucleotides c. Can be denature...

A:

Q: A myelinated axon conducts nerve impulses at a speed of 40 m/s. If the myelination made the speed of...

A: Neuron:  A neuron, also known as a nerve cell, is an electrically excitable cell that communicates w...

Q: Which of the following is on average the order in which you would encounter these three main biomes ...

A: A biome is a huge area defined by the plant, soil, climate, and fauna that it contains. The ocean, c...

Q: Which of the following has a primary amine (-NH2) as part of its structure?

A: Answer  - Guanine has primary amine NH2 as part of its basic structure.

Q: A behavioral ecologist is likely to study which of the following? Female mate choice and its relatio...

A: Ans- Behavioral ecology is the study of interactions between an organism and its environment in an e...

Q: What is one advantage of manipulative field experiments?

A: Field experiments are the experiments performed in everyday life in the real environment. Manipulati...

Q: What are the benefits of applying equations to ecological systems?

A: Equations applied on the ecosystem help us in: - Making concepts and parameters easier to comprehen...

Q: Organelle in a plant cell where photosynthesis occurs

A: Photosynthesis is the process of turning light energy into chemical energy that can then be released...

Tissue renewal

In multicellular organisms, tissue is a level of structure that consists of a group of physically and functionally identical cells and their intercellular substances. Unicellular organisms do not have tissues. Tissues are absent or poorly differentiated even in the simplest multicellular animals, such as sponges. However, more evolved multicellular animals and plants have specialized tissues that may organize and govern an organism's reaction to its surroundings. The word tissue is derived from the Latin word 'weave.' Plants and animals have various kinds of tissue systems that differ in their work and composition according to the different requirements.