Neanderthals DNA and behaviors show uS the ways in which they adapted to their environment over Europe, the Near East and Western Asia.   Decoding Neanderthals discusses why Neanderthals went extinct. Which do you think best explains their extinction, and why?

Q: The student used an eyepiece graticule to calculate the size of some of the onion cells. Figure I…

A: Introduction: Ocular units are the spaces on the ocular micrometer or eyepiece graticule, while…

Q: Lesson Plan about Heredity and variation through reproduction

A: Heredity (also known as inheritance or biological inheritance) It is the transition on of traits…

Q: Visitors to Plimouth Plantation are often surprised by the low ceilings and narrow door frames of…

A: A population's heritable characteristics change over successive generations, resulting in evolution.…

Q: I was wondering if taking ap biology is a bad decission as a freshman.

A: The College Board in the United States offers the Advanced Placement (AP) Biology course and exam,…

Q: According to Peter Gardenfors, representations can be O Detached and Unmarked Detached and Marked…

A: The two thematic concentrations in the Applied Biology major—Environmental Biology and Human Biology…

Q: Which genotype below is considered a carrier for an x-linked recessive disorder? a C XBXB xBxb xbxb

A: X-linked recessive disorder - Genetic disorders connected to mutations in genes on the X chromosome…

Q: Bison roamed free in an area along the eastern slopes of the Rockies, in what is now Banff National…

A: Gene frequency:-  it is usually represent the percentage of the population that have one type of a…

Q: Describe an easier method to detect the gene encoding for a specific toxin.

A: Gene:-  it consists of the sequences of nucleotide in DNA. And encodes a specific products including…

Q: ▶ Question 10 1 12 3 07 O 11 2n 11 10 6 8 and/or 8 7 In the figure above, which number represents…

A: Introduction: Gymnosperm flowers produce the pollen through the microsporangia of a male cone,…

Q: Explain the full progression of blood gas abnormalities in a severe asthma attack.

A: Asthma Is a chronic lung disease characterised by bronchial inflammation &…

Q: Which suite of reproductive features distinguishes angiosperms from gymnosperms?   A. The carpel,…

A:

Q: What happens when an ecosystem is in equilibrium?

A: In an ecosystem different organisms live together and interact with the environment. Ecosystem is…

Q: Please explain whether parents who have medium skin color (AaBbCc) can have children with the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: How many rabies cases are there in the world today

A: Rabies is a virus-based illness that is lethal yet curable. If they are bit or clawed by a rabid…

Q: In Anopheline mosquitoes an inversion associated with resistance to desiccation involves the…

A: Inversion Inversion refers to a rearrangement that involves two breaks within a single chromosome…

Q: What are SER? What are the functions of SER?

A: Introduction: The endoplasmic reticulum (ER) is commonly defined as a three-dimensional structure of…

Q: Question 33 (1 point) ✓ Saved Which of the following reactions is catalyzed by carbonic anhydrase?…

A:

Q: Describe the effect of the deletion on co-transformation of pure and pepN genes that are isolated…

A: Transformation is a process of transforming the genes of one strain and then transferring it to…

Q: Alcohol addiction is a condition in which a person experiences dependent on alcohol and difficult to…

A: Alcohol has been shown to quickly pass membrane barriers, influence the brain, and central nervous…

Q: What evidence supports the hypothesis that mitochondria preceded plastids in the evolution of…

A: Introduction Evolution is the key process that regulates the survivability and continuity of species…

Q: How many new viruses emerge every day

A: The living organisms on this planet can be categorized broadly into three groups - Plants, Animals…

Q: Part A Which of these structures, if present in a prokaryote, would prevent the organism from using…

A: Single-celled organisms known as prokaryotes lack a membrane, nucleus, and specialised organelles.…

Q: 4. Label the diagrams of cells with the following terms: diffusion, active transport, osmosis,…

A: Introduction As the cell is bounded by the membranous structure which does not allow the molecules…

Q: a typical PCR reaction what is happening in stages occurring at temperature ranges (a) 92–95°C, (b)…

A: Amplification of a specific DNA sample using the polymerase chain reaction (PCR) involves creating…

Q: A strain of Escherichia coli has been genetically modified to produce human protein. A batch culture…

A: Given that,  Initial conc. of substrate, i.e., glucose (S0)= 10 g/l Let's assume that, the substrate…

Q: Give a brief pathophysiology of diabetic kito acidosis.Including the signs and symptoms of DKA

A: Diabetic kito acidosis define as complication where the body produces excess blood acids…

Q: e homeotic mutation Antennapedia causes mutant Drosophila to have legs in place of antennae and is a…

A: Dominant gain-of-function mutations affect just one copy of an allele and result in the production…

Q: Analyze Approximately how much chlorophyll was present in the low-light plants after 24 hours? In…

A: In this experiment, we will be testing the effects of light intensity on the production of…

Q: Which species richness represents a larger island that is farther from the mainland? The red lines…

A: New immigrants to the island primarily come from the mainland. Since closer islands are simpler to…

Q: When red blood cells are placed in distilled water they burst open,why this was happens?

A: A solution with a lower solute concentration than another solution is called hypotonic, and a…

Q: 1. Frog skin is an excellent system for studying sodium transport across an epithelium. Frog skins…

A: Frog skin is moist and is covered by mucus glands. In addition to its lungs frog also respires…

Q: What is the melting temperature and G/C content of the following primers? a.) 5’…

A: A primer is a short single strand of DNA that serves as a starting point for DNA synthesis of a new…

Q: in horses, a classic champagne colored horse and an amber champagned colored horse produce a golden…

A: Introduction :- The horse is a domesticated, hoofed mammal with unusual toes. It is one of the two…

Q: Describe the effects of transcription factors on gene transcription

A: Transcription is a process by which the information of a strand of DNA is copied into a new molecule…

Q: Write:           A – if the item is associated with Transcription           B – if the item is…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: can u pls explain the photo? (direction: cut and paste or illustrate images of the given ecological…

A: Ecological communities are made up of all the species living together in an area. In community…

Q: What is photosynthesis?

A: Plants work as factories for carbohydrate production. Carbon Dioxide is generated by the cells of…

Q: Why is creatinine clearance a good estimate of glomerular filtration rate?

A: Creatinine is the chemical compound that is left behind after the energy producing cells in the…

Q: There are many types of PCR techniques available nowadays. Explain the concept of nested R and…

A: PCR stands for polymerase Chain Reaction. It is a technique which is used to amplify a given gene…

Q: What is the amount of ATP yield per one glucose molecule? Is this amount always achieved? If not…

A: ATP is usually formed by the process of respiration. Respiration maybe of two types -anaerobic and…

Q: Rubisco requires a bound CO2 for catalytic activity. What happens with rubisco when CO2 is bound?…

A: A crucial enzyme in photosynthesis, Ribulose Bisphosphate Carboxylase/Oxygenase (Rubisco), is…

Q: Based on this information, answer the following questions. a) What is the possible microbial…

A: Inflammation of the cerebrospinal fluid (CSF) and meninges surrounding the brain and spinal cord is…

Q: Explain the way to elucidate differences in tRNA needed in the human and mitochondrial genome.

A: The transfer ribonucleic acid is another name for the RNA. The molecules known as tRNA are in charge…

Q: n Cohen-Boyer’s recombinant DNA procedure, ___i___ must be used for both the bacterial DNA and the…

A: The Cohen-Boyer experiment was to construct recombinant plasmids carrying the rRNA gene from the…

Q: he table below summarizes the features of 4 different flowers, A to D. Flower petal colour…

A: Pollination is the process of moving pollen grains from a flower's male anther to its female…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: What are degenerate primers? Name two uses for degenerate primers.

A: Introduction  A primer is a small sequence of nucleic acids that serves as the precursor to DNA…

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: What is the evolutionary significance of the enzymes; superoxide dismutase, catalase and peroxidase?

A: The enzymes can enhance the rate of the chemical reaction faster without changing themselves. It…

Q: Structure and functions of root hair cells?

A: The root hair cell is an epidermal offshoot that forms hairs of the root of the plant.  Essentially,…

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth.  Human evolution is an outcome of interaction among the following processes: