Q: Directions: Identify the citation style (Chicago Manual of Style, MLA, APA or ASA) used in the follo...
A: Citations are used to acknowledge persons whose creative and intellectual works you used to support ...
Q: Two islands lie off the coast of Florida. One is larger and the other is closer to the mainland. Wha...
A: Species variation in a population is dependent on two major factors which are genetic mutations whic...
Q: abiotic factors t
A: An ecosystem is a community of living and non-living things that work together it consists of abi...
Q: .Mechanical isolation
A: Mechanical isolation is a form of reproductive isolation which prevents 2 different species from int...
Q: For each case study, identify what type of communication disorder the child has. You must state at l...
A: A communicationproblem is a developmental or acquired disability in a person's speech, language, or...
Q: "Polymerase binding is never very efficient unless CAP is alsopresent to facilitate the process". Ex...
A: A functional unit of DNA comprising a cluster of genes controlled by a single promoter is called an ...
Q: Why is the growth curve for most populations S-shaped?
A: A growth curve is a graph depicting the progression of an event through time. The number of organism...
Q: his display is called “semaphoring”. Why was this behavioral adaptation necessary for this particul...
A: All frogs and toads are classified in the Anura order , one of the three orders that categorize amph...
Q: Which of the following is/are too small to have been discovered before the invention of the electron...
A: Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among the biological ...
Q: What if the purpose of bacterial culture? Why might it be useful to grow bacteria?
A: According to question what is the purpose of bacterial culture. Why might it be useful to grow bact...
Q: The function of proteins can be regulated in a number of ways. What is cooperativity, and how does i...
A: Proteins are massive biomolecules and macromolecules made up of one or more long chains of amino aci...
Q: About STOMATA What is the benefit of keeping them open? What it the benefit to keeping them closed...
A: Answer : stomata are present on the leaves of the plants and are responsible for the exchange of gas...
Q: Male side-blotched lizards display throat color polymorphisms; some males have orange throats, some ...
A: Allele frequency: allele represent the alternative form of a gene. It is measured by- Allele frequen...
Q: Why are chemical stains required for visualizing cells and tissues with the basic light microscope?
A: Cell staining is a technique that is used to better visualize cells and cell components under a micr...
Q: The primary aim of fixation is to preserve the morphological and chemical integrity of the cell. Exp...
A: Fixation is a process by which biological tissue are processed with specific type of fixatives, so t...
Q: Describe an area in which linguistic inclusivity may become a relevant issue (e.g., race, sex, econo...
A: For a fifth of the world's population, inherited caste identification is a significant driver of lif...
Q: What are the advantages and disadvantages of using the Slide Culture technique?
A: Slide culture technique is mainly utilized for the preparation of fugal colonies. Fungi are consider...
Q: Predict the level of genetic activity of the lac operon aswell as the status of the lac repressor an...
A: Lac operon is regulated by positive and negative control.
Q: How much fat (in grams) would the body have to burn to produce the daily minimum requirement of 40 k...
A: Answer :- Option (C) is correct. - approx 22 to 23 kg of fat.
Q: Do you agree withe the advancement of genetic engineering? Explain your answer.
A: Genetic engineering alludes to the immediate control of DNA to modify a life form's attributes with ...
Q: Give 3 qualities of each: a.Good squash preparation b.Good whole mount slide c. Good slides
A: Squash preparation Before microscopic inspection, a tiny tissue specimen is compressed between two s...
Q: A3 Explain why “seeding”, at least in principle, dramatically speeds up the process of fibrillation....
A: Fibrillation of a protein generally consists of several phases including association/dissociation of...
Q: How does individual behavior decrease biotic potential? a) It reduces the reproductive rates of indi...
A: Biotic potential is the maximum reproductive capacity of an organism under optimum environmental con...
Q: Which group of the following is probably the least likely to have the harmful Tay Sachs alleles toda...
A: Tay Sachs disease or GM2 gangliosidosis occurs when a child inherits a mutation in the HEXA gene fr...
Q: Klariz, a 28-year-old woman with type o blood and Ricci, a 30-year-old man with type AB blood are ex...
A: Monohybrid cross is a type of genetic cross between individuals.
Q: 1. If a flower is unable to be pollinated from the pollen of the same species, than this is a a. Mec...
A: Temporal isolation It is a type of reproduction isolation mechanism among sexual organisms in which...
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome recognize...
A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome. ...
Q: You have been asked to determine the bacterial count in a sample of water. The number of CFU from 1 ...
A: The CFU count is the number of viable cells per ml of the sample. The CFU count is done on the basis...
Q: How is the diversity in human skin color related to human environmental adaptation?
A: Human skin color variations are adaptive characteristics that are linked to geography and UV exposur...
Q: Distinguish between smooth and rough endoplasmic reticulum in terms of both structure and function.
A: The endoplasmic reticulum is membrane bound organelle consisting of delicate branching and anastomos...
Q: 1. Errors in cellular division can lead to a, Polyploidy. b.Tetraploids. c.New gametic chromosomal n...
A: The fundamental and active biological process by which a parent cell, after replication of its comp...
Q: Define the Comparison of Gene Activity ( +or -) in the Presence or Absence of Lactose for Various E....
A: The expression of the lac operon is regulated by operator sequence and repressor protein.
Q: paedomorphosis,
A: Pedomorphosis is an alternative process to metamorphosis in which adults retain larval traits at th...
Q: Assuming all genes involved in the metabolic pathway have been sequenced from various microorganisms...
A: Isotope labeling is a technique utilized in experiments to identify or target a specific molecule or...
Q: How do proteins function in transporting materials into the cell?
A: Cells can be defined as the basic functional unit in a living organism. They are the building blocks...
Q: The similarities between the bone structure of a human hand and a cats paw suggest what? a. a commo...
A: Both human and cats are vertebrates that possess vertebral column. The evolution of different organi...
Q: Why is it necessary to maintain aseptic conditions in microbiology?
A: Aseptic conditions means microbs free environment. Microbs means bacteria, virus and fungi. It may c...
Q: What Are the Organization and Structure of Cells?
A: Cells come in a variety of structures and sizes but all share the same trait features, such as a cel...
Q: In the sliding filament theory of contraction, what prevents the filaments from sliding back to thei...
A: Sliding filament theory of muscle contraction: this theory states that sliding of actin filament pas...
Q: Each generation is represented by a Roman Numeral and each individual by a number. Based on the pedi...
A: pedigree is a family chart showing the inheritance of a particular date through several generations ...
Q: How long does it take to get in shape? When answerin consider the following: What factors account fo...
A: If you’re consistent about working out and dieting properly for a period of 3-4 months, At 6 to 8 w...
Q: How much work is it to obtain such a large progeny sizein corn? Which of the three genes would take ...
A: Introduction: Mendel discovered three laws describing the inheritance of factors from the parental g...
Q: what is triple code
A: The genetic code refers to the progression of data from genes to proteins. The triple code is named ...
Q: Explain the relationship between protein folding and protein function.
A: A three-dimensional configuration of a protein is called its structure. Protein folding takes place ...
Q: In Figure 4-14, in the bottom row four colors are labeledSCO. Why are they not all the same size (fr...
A: Crossover is the event of recombination that occurs during meiosis.
Q: What is the characteristic function of nervous tissue?
A: Introduction :- The nerve tissue,is the major component of our nervous system. It keeps track of and...
Q: What is peritoneum ? Write down its many layers?
A: The serous membrane is a thin membrane that outlines interior body cavities and organs such as the h...
Q: Speciation on islands is influenced by a) island gigantism b) adaptive evolution c) variation in spe...
A: Speciation is the phenomenon by which a different species emerges through evolution.
Q: How does the structure of the nucleus affect how information stored in DNA is used by the cell?
A: The blueprint that determines everything a cell does and all of the products it produces are found i...
Q: what are the genotypes of the offspring?
A: Genetics is a branch of biology that tells about genes, genetic variation, and heredity in living th...
Can you please answer this questions with details, I need to understand how to know which is 5' overhand and which is 3' overhang, thank you. ( Question attached)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Some restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments with sticky ends. What is the difference? What type of ends do AatII and DraI produce?Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?If you wanted to create recombinant DNA using this enzyme(3' T A 5'), would you have to cut both samples of DNA with this enzyme, or could you use two different restriction enzymes? Explain.
- In experiments using polymerase chain reactions (PCR), it is often more difficult to amplifythrough regions of DNA that are high in GC content versus those regions that are either lower inGC content or are AT-rich. Based on your knowledge of DNA structure, explain why.What is the dna strand sequence for phosphate sugar backbone? What are sticky ends in restriction enzymes can you examples to help me understand. Does where you cleave affect the length of the sticky ends overhang? 5-3directionalytgg atc gat atc gcc aat.Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
- Certain restriction endonucleases produce cohesive (sticky) ends. This means that they: a. stick tightly to the ends of the DNA they have cut. b. cut both DNA strands at the same base pair. c. make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. d. cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. e. cut in regions of high AT content, leaving ends that can form more hydrogen bonds than ends of high GC content.You desperately need to join two DNA fragments, one with an EcoRl site and the other with a BamHI site.Both enzymes leave 5' overhangs cutting after the first base. EcoR/ cuts at gaattc, BamHI at ggatcc. Whichof the following statements is true? A. You can not ligate these fragments.B. You can remove the overhangs with another restriction and ligate the blunted ends.C. You can fill in the ends with DNA polymerase and ligate the blunt ends.D. This can be done directly as the 5' overhangs anneal.E. You are better to replace EcoR/ with a related enzyme that leaves a ligatable 3' overhang. Please explain why it's CA molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)
- You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences).If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)