You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.

You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Similar questions

You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
Ben used the following primer pairs to amplify the COI region of his DNA template: Afterwards, he used Agarose Gel Electrophoresis to visualize the PCR products. Based on the gel: a) Was he able to successfully amplify the desired region in all replicates? b) Are there errors in Ben's gel? Does he need to repeat his PCR?
The PCR reaction contains deoxynucleotide triphosphates (dNTPs) in order to construct new DNA. There are four different dNTPs used in this reaction. Which answer below lists the four different dNTPs used in PCR? A) DNA polymerase, helicase, ligase, topoisomerase B) adenine, guanine, cytosine, thymine C) adenine, guanine,cytosine, uracil D) Alanine, guanine, cytosine, Theron one
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
PCR is an exponential copying of the template strands and can be represented by the function: y = a * 2n, where a is the initial number of template copies and n is equal to the number of cycles PCR has gone through. How many DNA fragments would be produced after: 15 cycles? 13 cycles with 13 starting template strands? 29 cycles with 32 starting template strands?
Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each strand. Sticky ends are useful in making recombinant DNA because Select one: a. Sticky ends contain the exact same nucleotides that allows fragments to splice together. b. Sticky ends contain nucleotides with complementary bases that allows fragments to splice together. c. Sticky ends contain the exact same nucleotides that can form hydrogen bonds. d. Sticky ends contain nucleotides with complementary bases that can form hydrogen bonds.
The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does the number of copies of the DNA region being amplified change at the end of each cycle of the polymerase chain reaction? Group of answer choices a. The number of copies triples (or triplicates). b. The number of copies does not change. c. The number of copies quadruples (or quadruplicates). d. The number of copies doubles (or duplicates). e. The number of copies halves.
Put the steps of one PCR cycle in the correct order: The PCR reaction mixture is heated to about 70 degrees, which is the optimum temperature for the polymerase to build the new strands of DNA, starting at the 3' end of the primer. The PCR reaction mixture is heated to 95 degrees Celsius, which denatures the double stranded template DNA. The PCR reaction mixture is cooled to about 50-55 degrees, which allows the primers to find their complementary site on the template and "anneal" the
During a PCR reaction, the step in the cycle where dNTPs are added to the primer 3’ ends to fill in the strand complementary to the template by DNA polymerase is called: Annealing Extension Hybridization Melting.