Number of Difference in Amino Acid Sequence in Cytochrome-C Protein between Human and Organisms below Snapping Turtle Rhesus Monkey Kangaroo Bullfrog Tuna Guide Questions: 1. How do you describe the data from the amino acid sequence to anatomical features provided in the cladogram? Are they generally associated with one another? 2. Do you agree that the more differences in amino acid sequence, the more closely related organisms are? If yes, does it mean they shall be grouped under the same biological classification? Explain your answer. 3. In the molecular data provided, describe how human and rhesus monkey relate with one another. 4. Why do you think turkey and chicken are different species despite the fact that they have the same sequence of amino acids for cytochrome-c protein?

Number of Difference in Amino Acid Sequence in Cytochrome-C Protein between Human and Organisms below Snapping Turtle Rhesus Monkey Kangaroo Bullfrog Tuna Guide Questions: 1. How do you describe the data from the amino acid sequence to anatomical features provided in the cladogram? Are they generally associated with one another? 2. Do you agree that the more differences in amino acid sequence, the more closely related organisms are? If yes, does it mean they shall be grouped under the same biological classification? Explain your answer. 3. In the molecular data provided, describe how human and rhesus monkey relate with one another. 4. Why do you think turkey and chicken are different species despite the fact that they have the same sequence of amino acids for cytochrome-c protein?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter32: Deuterostomes: Vertebrates And Their Closest Relatives

Section: Chapter Questions

Problem 1ITD: The phylogenetic tree for vertebrates depicted below was constructed from sequence data for two rRNA...

See similar textbooks

Similar questions

Reading abstracts. Read the research abstracts and answer the following questions. (a) What is the objective of the study? (b) What type/s of data were used in the study? (c) What were the results? (d) Did the researchers employ a combination of morphological and molecular data to determine evolutionary relationships of organisms?
Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG
Molecular phylogenetics can compare the sequence of amino acids in proteins as well as (blank) to identify the characters used to construct a cladogram.
In the example below, the letters represent amino acids that make up a polypeptide found in all the vertebrates listed. Use the steps outlined above to construct a cladogram from the different amino acid sequences given. Assume that the sequences are already aligned and begin with comparing the number of differences between species.
A cladogram shows the evolutionary relationship between humans, chimpanzees, and gorillas. The cladogram currently shows humans and chimpanzees with a more recent common ancestor compared to gorillas. Which piece of evidence, if true, would most likely weaken this hypothesis? Amino acid analysis of the cytochrome shows significant differences in the sequence of amino acids between humans and goriffas. DNA sequence analysis of the hemoglobin alpha gene shows that humans and chimpanzees have a more similar sequence to each other than they do to the gorilla's DNA sequence. The cells of the eye in embryos of gorillas and humans follow a similar pattern of development chimpanzee embryos are different Fossils of humans appear in deeper sedimentary rock layers compared to fossils of chimpanzees.
Protien searches are usually more informative than DNA searches. Perform a BLASTP search using RBP4 (NP_006735), restricting the output to Arthpoda (insects). How many database matches have an E-value less than 1.0 in each search ?
Based on this matrix, is my cladogram correctly done? 1.a) What species on the cladogram are endothermic (fully endothermic species only=those that maintain their body temperature only with their metabolism = not sharks for instance)? 1.b) Considering the location and relationship of endotherms on the cladogram, what type of character (homologous, homoplasy: convergence or reversal) do you think endothermy is? try to use specific terminology: character, homologous characters, nom homologous characters, character states (or evolutionary stages of a character), ancestral (plesiomorphic), derived (apomorphic), homoplasy, convergence, reversal....
Read the abstracts and answer the following questions: a)Did the researchers employ a combination of morphological and molecular data to determine evolutionary relationships of organisms? b) what type/s of data were used in the study? b)
There are 27 sequences from 27 individuals belonging to an unidentified group of organisms. Eleven (11) sequences were mined from NCBI while the rest are unpublished sequences from Mindanao. Sequences labeled with "SSL" are from Agusan Marsh while sequences labeled with "CKL/CITLR" and "CWL" are from Camiguin Island and Dinagat Islands respectively. Finally, sequences labeled with "MSLA" are from Mt. Magdiwata. From the nucleotide results and generated phylogenetic tree below: a) What group of organisms is represented by the phylogenetic tree? b) Identify the source (species) of each sequence. c) How many species are present in the generated tree? d) What species is considered as the outgroup? e) What genetic marker is utilized to generate the sequences? f) Which specimen group is more closely related to "SSL"? CKL or MSLA? Justify your answer h) Based on the results, what possible species name can be assigned to the MSLA group?
Topic: Cladogram Instructions: Please examine the given cladogram. The letters corresponds to the name of the animals, while the numbers corresponds to the traits or characteristics. Write the correct name the name of the animal and the trait.Study the given table, construct a cladogram and answer only the given questions. 1. Which animal is in letter A? 2. Which animal is in letter B? 3. Which animal is in letter C? 4. Which animal is in letter D? 5. Which animal is in letter E? 6. What trait is in no.1? 7. What trait is in no.2? 8. What trait is in no.3? 9. What trait is in no.4? 10. What trait is in no.5? Thank you.
Can you please do both of the part to this question, part 1 filling the cart and part 2 drawing the Cladogram Part 1: Produce a character matrix for the fish. Note:Depending on how you define the fins on the ventral side of the fish you could have 9 characters or 10 characters - if you define it as a numerical character with states 0,1,2 you would have 9 characters total. If you define the fins as two separate binary characters ( a pelvic fin and an anal fin) you will have 10 characters. We recommend doing it as two separate characters: Anal fin (presence/absence) and pelvic fin (presence/absence). Character OG1 OG2 SpA SpB SpC SpD SpE Part 2: Construct the Cladogram for the fish using your Character matrix
Please answer only A, B, C. I will repost this question for the rest. Include a brief explanation for each answer. Thank you very much :) The table below provides seven organisms differentiated with six simple characters (0 = absence, 1 = presence). For your convenience, a slanted cladogram of their relationship is also provided below the table. Identify which character is/are: A. Autapomorphic: B. Synapomorphic: C. Apomorphic: D. Pleisiomorphic: E. Autapomorphic for lynx and chimpanzee: F. Synapomorphic for lamprey and shark: