Match the hormones involved in calcium homeostasis below with the glands or organs that secrete them [Choose ] parathyroid gland calcitonin kidneys parathyroid hormone thyroid gland cali or Vit D | Chooke

Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...

A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...

Q: You have a precursor protein that is translated in the cytosol with an N-terminal mitochondrial loca...

A: The mitochondria is a double membrane bound cell organelle that is responsible for energy (ATP) prod...

Q: What is the purpose of using an “outgroup” when reconstructing a phylogenetic tree? (Write 4 points)

A: The outgroup is used as a point of comparison for the ingroup and specifically allows for the phylog...

Q: Determines the order of the four chemical building blocks - called "bases" - that make up the DNA mo...

A: A nitrogenous base is a molecule with the chemical characteristics of a base and contains nitrogen. ...

Q: In a recent study, scientists used gene editing to treat both sickle cell disease and beta-thalassem...

A: Sickle cell disease and beta thalassemia are genetic disorders caused by errors in genes of haemoglo...

Q: Malaika is a 30 year old African lady with a history of Schizophrenia. She is currently taking Olanz...

A: Malaika is currently taking Olanzapine 20 mg, a drug to treat Schizophrenia. Olanzapine : Olanzapine...

Q: Suppose you identify a new gene in mice. One of its alleles specifies white fur, another specifies b...

A: Incomplete dominance is a type of inheritance pattern which shows blending of two alleles in F2 gene...

Q: In what ways are mitosis and meiosis similar?

A: The similarities between mitosis and meiosis are as follows: 1.Mitosis and meiosis take place in the...

Q: Suppose that you are asked to write a new class for DNA. What are the main attributes and functions ...

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...

Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...

A: Kabocha Squash- Kabocha squash is full of nutrients, boosts immune system, prevents diabetes. Treats...

Q: A gardener harvested 3,697 seeds from cross breeding a pure line red-flower petunia and pure line wh...

A: The characteristic that initially shows up or is shown in the organism is known as the dominant trai...

Q: (d) Given below is an apparatus used to study a particular process in plants. Study the same and ans...

A: (i) Ganong's Potometer. (ii) Because not all of the water taken up by the plant is used for transpir...

Q: EMBRYOLOGICAL explanation  of  The dorsal mesocardium is a ventral mesentery.

A: Between the mouth and the anus, the vertebrate gut features a continuous dorsal mesentery that aids ...

Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...

A: Introduction :  thermal energy - every objects has thermal energy.  It's the movement of molecules w...

Q: Skeletal muscles move as coordinated by the nervous system. sympathetic somatic O peripheral O auton...

A: Skeletal muscles/Voluntary muscles Transverse lines are found at regular intervals. Hence these mus...

Q: WHAT IS SNAIL IS CERCARIA OR METECERCARIA

A: Snail is CERCARIA What is CERCARIA?     Cercariae are the final intra molluscan larval stages that e...

Q: Associate the biochemical reaction in TSI agar to certain genera or species. Reaction Possible Organ...

A: The triple sugar iron test ( TSI ) in microbiology it is a  test which use for  ability to test micr...

Q: what are the differences between mitochondrial RNA polymerase and RNA polymerase ? and why does mit...

A: *The mitochondrial transcription is a multi-component system consisting of, at minimum, the mitochon...

Q: Transpiration is when a plant release water vapor through its stomata which are pores its leaves and...

A: Transpiration is the course of water development through a plant and its dissipation from airborne p...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: tabulate similiraties and differences of mitosis and meiosis

A: Introduction:- Mitosis and meiosis are the two ways that cells divide and reproduce. Meiosis produce...

Q: What is the probability of having red flowers when red snapdragon and white snapdragon are crossed? ...

A: Incomplete dominance refers to the inability to mask the recessive phenotype completely. Hence when ...

Q: What are the typical features of the age pyramids of underdeveloped countries?

A: Introduction I'm this question we will discuss about the typical features of the age pyramids of und...

Q: Which is NOT a reason why the fruit flies make goad model organistrs? simple food requirements they'...

A: Introduction:- Animals such as mice, flies, and monkeys have all been employed in the past for anima...

Q: There are two figures- one for vector control plate & another PCRinsert+vector experimental plate.  ...

A: We know that genetic selection of transformed or transfected cells is one of the significant step of...

Q: What is the climax stage of an ecological succession?

A: Introduction:- Ecological succession is the process that describes how the structure of a biological...

Q: Why did Gregor Mendel choose pea plants as his experimental organism?

A: It was during the mid-nineteenth century thas headway was made in the understanding otl inheritance....

Q: What are cerebrovascular accidents?

A: Introduction In this question we will discuss about the cerebrovascular accident

Q: Why are GMOS considered a threat to the environmental safety?

A: Introduction In this question we have to discuss why GMOs considered a threat to the environmental s...

Q: If the luciferase open reading frame is 1,650 bp in the control plasmid, and the Rel open reading fr...

A: The mRNA is produced from the DNA by transcription process and then this mRNA is used for the protei...

Q: What determine what molecule will act as the predominant electron acceptor in a sediment layer? a. t...

A: *Microorganisms present on subsurface environments competes for electron donors and acceptors . *As ...

Q: how many cells does  Archaebacteria have

A: * Archaebacteria are prokaryotes  thought to be bacteria. *They have a unique ribosomal RNA type. *T...

Q: are the gene pairs in non allelic interaaction, recessive epistasis independently segragating?

A:  Epistasis:The interaction of genes that influence phenotype" Epistasis is a phenomenon in genetics ...

Q: 22

A: Motor neurons are components of peripheral nervous system which conduct efferent impulses from the s...

Q: Repolarization occurs because Multiple Choice more sodium ions diffuse into the cell than potassium ...

A: At the resting stage, the Na+ and K+ channels remain closed.

Q: Instructions: have a look at “Figure 2.pdf”. This shows a diagram mapping the Arabidopsis Rab protei...

A:  There are few general  points that should kept in mind . these are as follows: About  Arabidopsis ...

Q: With a dihybrid cross, now many individuals would you expect, out of 16, to show BOTH dominant trait...

A: Introduction:- A breeding attempt between two creatures that are identical hybrids for two traits is...

Q: Tell how to make a 1 M solution of Mg3(PO,), and a 0.1 M solution of caso,. Ca.SO4.

A: The term molarity can be used to describe the solute concentration in a particular solution. The for...

Q: disinfectants, antiseptics and antibiotics

A: Disinfectants are a type of  chemicals that destroy pathogens of causing of disease or other harmful...

Q: A pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to provid...

A: *Electrophoresis is a technique used to separate genetic materials like DNA and RNA and  protein bas...

Q: Describe the hair and give the components

A: Hair Thin elongated keratinized structures present over almost all of the body surface hair is forme...

Q: Describe what the early atmosphere was like and what cause a large amount of oxygen (O2) to build up...

A: Early atmosphere  Around 4.6 billion years ago, the Earth was formed from a heated mixture of gases ...

Q: Male Reproductive System: Complete the table Letter Structure Function A А prostate gland I B В vas ...

A: Introduction: • The prostate gland is a chestnut-shaped gland located between the bladder and penis ...

Q: In sweet pea plants, an allele for purple flowers (P) isdominant when paired with a recessive allele...

A: Mendel is famously referred to as the “Father of Genetics.” He gave three laws describing the inheri...

Q: How would we amplify the target DNA associated with PTC tasting? O We use restriction enzymes to amp...

A: PCR polymerase chain reaction, is the most useful invitro techniques nowadays to amplify double stra...

Q: Data Table: Comparison of Mammalian Species (Humans, Mice, Cats, and Baboons) Test 3 Nicotine Recept...

A: Nicotine receptors in Brain. Neuronal nicotinic acetylcholine receptors (nAChRs) are a family of lig...

Q: What phase is the cell in #5 in? O Prophase O Metaphase O Interphase Anaphase

A: *The cell division mitosis will have four stages  Prophase  Metaphase Anaphase Telophase * During ...

Q: (0 - E)2 Phenotype Observed Expected Yellow & Non-starchy seeds 470 (#27) # 29 Yellow & Starchy seed...

A: The Chi-square test determines the probability of difference between the observed and the expected v...

Q: If you could replace all of the plant ATP synthase with ATP synthase enzymes from animal cells, orie...

A: Chemiosmotic hypothesis explains the mechanism by which ATP is synthesized by the ATP synthase compl...

Q: Macroevolution Please give examples; How is this studied

A: The evolution of groupings larger than a single species is referred to as macroevolution. Simple evo...

Anatomy and Physiology of Special Sensory Organs

Sensory organs can be labeled as special sensory structures that permit sight, hearing, odor, and flavor. Sensory structures permitting proprioception, touch, thermal, and pain perception can be classified as more advanced sensory organs. The sensory neurons are trained to find out modifications in the external and internal conditions so that a person's body can react to that change. A stimulus is the first signal that is recognized by any sensory receptor of the body. Stimulus is an impulse generated when there is a change in the surroundings of a person. For example, a heated environment will alert the brain through the thermal sensory organs and generate a reflex accordingly.

Sensory Receptors

The human sensory system is one of the most complex and highly evolved structures, which processes a myriad of incoming messages. This well-coordinated system helps an organism or individual to respond to external stimuli, appropriately. The sensory receptors are an important part of the sensory system. These receptors are specialized epidermal cells that respond to external environmental stimuli. These receptors consist of structural and support cells that form the peripheral unit of the receptor and the neural dendrites which receive and detect the external stimuli.