ton 39Which of the following genetic markers would you utilized to compare the molecular sequences of bacteria, humans, elephants, and fungi?ntO a cytochrome e osidase i (coi) geneO b. Ribosomal RNAO c cytochrome-b geneO d rbet genePrevious page

Early genetic maps, developed in the early 20th century for fruit flies such as fruit flies, use…

Answered: O a cytochrome c oxidase O b Ribosomal…

Science

Biology

O a cytochrome c oxidase O b Ribosomal RNA c cytochrome-b gene

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Related questions

Q: • What type pf chemical reaction took place for product A to be produced? • Kindly label the name…

A: There are many metabolic process takes place inside the human body . During metabolism , ammonia ( a…

Q: FIGURE 6D CH, — сн,—он NAD* CH-C-H NADH (а) C-OH + C-OH C-OH C-OH C=0 H-C-NH2 H-C-NH2 c=0 CH3 CH3…

A: Proteins that act as a catalyst in the chemical reaction are termed Enzymes. They help in the…

Q: Which of the following statements is correct about Cytochromes? Select one: O a. Cytochrome a + a3…

A: Cytochromes are redox-active proteins that contain a heme with a central Fe atom at its core.

Q: Peroxisomes got their name because hydrogen peroxideis:a. used in their detoxification reactionsb.…

A: Peroxisome is a membrane-bound organelle occurring in the cytoplasm of eukaryotic cells. Peroxisomes…

Q: Cyanide inhibits- Pyrurate kinase Cytochrome C oxidase Enclase

A: Cyanide is a rapidly acting chemical that can exist as a colourless gas such as hydrogen cyanide or…

Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…

A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…

Q: An apoenzyme is where the _______ is located.a. cofactor b. coenzyme c. redox reaction d. active…

A: The enzyme is a type of protein molecule that is present in all living organisms and plays an…

Q: An enzyme that is not attached to any mitochondrial membrane 1-pyruvate decarboxylase 2-succinic…

A: The mitochondria is commonly known as the powerhouse of the cell as this is where ATP synthesis…

Q: Why is th tca cycle central pathway of metabolism

A: Biochemical reactions involves a series enzyme-catalyzed reactions that involves the generation of a…

Q: omplex III oxidizes _____ and reduces _____. NADH; CoQ FAD; CoQ Succinate;…

A: An electron transport chain constitutes of a series of protein complexes that transfer electrons…

Q: Carbamoyl phosphate is formed from a.ATP b.C02 c.H20 d.NADH

A: The urea cycle is the biochemical pathway that converts ammonia into urea. The pathway channels all…

Q: Enzymea make reactiona go, by the activation energy of the reaction.

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Select the correct answer from the answers provided. To digest cellulose in its environment, a…

A: Enzymes can play out their exercises both inside just as outside of the cell, where they are…

Q: What compound receives electrons from NADH? a. FMN b. ubiquinone c. cytochrome c1 d. oxygen

A: The electron transport chain is a progression of complexes that transfer electrons from electron…

Q: I don't need a long answer.... Holoenzyme is a combination of a protein and one or more substances…

A: A substance that assists a chemical reaction to occur is known as a catalyst. Special biomolecules…

Q: Compare and contrast cytochrome p450 (CYP) and flavin- containing monooxygenase (FMO)

A: Cytochromes P450 (CYPs) are a superfamily of enzymes that contain heme as a cofactor functioning as…

Q: ADP Coenzyme A (COA). FADH2 NADH

A: Mitochondria is a double membrane-bound organelle present in all eukaryotic organisms.

Q: The term anaerobic describes a reaction occurring I Select ]

A: Cells are the basic structural and functional unit of an organism and is of two types namely…

Q: Which cyclooxygenase enzyme is associated with inflammatory pain? COX-1 OA. O B. COX-2 Both COX-1…

A: A spontaneous feeling of pain that occurs responding to tissue damage or inflammation, is termed as…

Q: Select the correct answer from the answers provided. An apoenzyme is where the is located. a.…

A: Answer: Introduction: Enzymes are biocatalyst which increase the rate of reaction. In an…

Q: Define the following terms: a. turnover b. cyt P450 c. detoxication d. detoxification e. epoxide

A: Enzyme is a biological molecule that catalyzes a biochemical reaction and increases the rate of…

Q: Anabolism refers to the metabolic reactions involved in building larger molecules and…

A: Metabolism is the totality of chemical reactions that occur within each cell of a living creature…

Q: Describe the activities of the cytochrome P450

A: Cytochromes P450 belong to the class of oxygenases. Cytochromes P450 (CYPs) are enzymes containing…

Q: What name is given to the inactive precursor of an enzyme? A) preenzyme B) antigen C) zymogen D)…

A: Enzymes require an ideal pH range to operate properly. The tertiary structure of the enzyme is…

Q: A Holoenzyme is * Apo enzyme O Coenzyme O Both of them None of them

A: Enzymes are biomolecules that play a vital part in all biochemical reactions by increasing their…

Q: OH NH+ он он + NADPH + H • NADP O hydrolase oxidoreductase O transferase O lyase isomerase ligasc

A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…

Q: Can you please answer this question and say the correct letter

A: Oxidative phosphorylation is the last step of the process of cellular respiration in which the high…

Q: _____________ catalyzes the redox reaction between UQH2 and cytochrome c.

A: UQH2 and cytochrome c are the part of electron transport chain. Both UQH2 and cytochrome c acts as…

Q: Your microorganism produce black color in peptone iron agar grown at 37 degrees Celcius…

A: Enzymes are the biological catalysts that have the ability to increase the rate of metabolic…

Q: Cyanide permanently disables cytochrome C3 only. How does cyanide kill people?

A: Cytochrome C3 is low redox potential cytochrome specific, Cyanide is a potent toxicant that produces…

Q: Allosteric enzymes forms which shape of curve? O Linear O Hyperbolic O Bell-shaped Sigmoid shaped…

A: Enzymes are biological catalysts that help organisms speed up chemical processes. Enzymes are…

Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…

A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…

Q: Research scientists are trying to clone a gene. To accomplish this task, they join two pieces of…

A: Molecular or gene cloning is the process of inserting a foreign gene segment into a plasmid vector.…

Q: Define the following terms:a. cytochromeb. glycerol phosphate shuttlec. malate-aspartate shuttled.…

A: Proteins are biomolecules consisting of amino acid chains. They have different body roles,…

Q: A reducing sugar is a sugar that goes through a/an reaction. A. Oxidation reaction B. Reduction…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: The Cave cycle begins when CO2 reacts with A G3P B Ribulose bnphosphate (RuBP) C Oxaloacetate D.…

A: Photosynthesis is a metabolic phenomenon in which water reacts with carbon dioxide in the presence…

Q: Detoxification of lipid drugs and other harmful compounds in ER is carried out by? a) Cytochrome D…

A: Introduction - Detoxification is the process of removing a drug of dependency from the body without…

Q: Which protein does not hydrolyze other proteins? O Carboxypeptidase O Trypsin O Cytochrome C O CNBR

A: Protein is a polymer of amino acid. The peptide bond is found between two amino acids in proteins.

Q: Draw the product of the reaction below. (Upload your answer here) H- но ? NaBH4 HO -H H- ČH2OH

A: Given structure :- D-GALACTOSE (monosaccharide) In presence of NaBH4 , REDUCTION reaction…

Q: Define the following terms: a. vitamin B1 b. PDP c. OAA d. glyoxylate cycle e. electron acceptor

A: The metabolism is series of chemical reaction that are involved in maintaining the living state of…

Q: cytochrome b Cytochrome oxidase 1. Complex I NADH 2. Complex II Ubiquinol dehydrogenase 3. Complex…

A: Electron transport chain involves four complexes which are responsible for the oxidation of NADH and…

Q: What is the effect of each of the following inhibitors on electron transport and ATP formation by…

A: The electron transport chain is series of protein complexes that transfers electrons from electron…

Q: As a representation of the respiratory chain, what is wrong with thispicture? There are four…

A: Respiratory chain is also known as Electron Transport Chain, is to release and utilize the energy…

Q: The molecule necessary fpr carbon to enter the Krebs cycle is _______________________

A: The molecule necessary for the carbon to enter the Krebs cycle is coenzyme A.

Q: Which of the following gives electrons to cytochrome oxidase? O Oxygen O NADH Dehydrogenase O bc…

A: Cytochrome oxidase is the end of the electron transport system. this process developed inside…

Q: Enzyme B requires Zn2+ (Zinc ion) to be functional. Zn2+ is a Cofactor O Product O Coenzyme O…

A: Coenzymes are chemical molecules that are needed for enzymatic performance by numerous enzymes.…

Q: The water-oxidizing complex provides electrons to: a. P680 b. P450 c. P700 d. Cytochrome c

A: Photosynthesis is the process of converting light energy to chemical energy. Basically, the sunlight…

Q: Supply the missing enzymes/product that is labelled with white box and number. ALL ANSWER MUST BE ON…

Q: T or F. Kreb’s Cycle enzymes are present in virtually all bacteria in order to generate…

A: Kreb's cycle is a sequence of biochemical reactions in which Acetyl CoA along with oxaloacetate…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

ton 39
Which of the following genetic markers would you utilized to compare the molecular sequences of bacteria, humans, elephants, and fungi?
nt
O a cytochrome e osidase i (coi) gene
O b. Ribosomal RNA
O c cytochrome-b gene
O d rbet gene
Previous page

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3 Answer:

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb. ATCCGCGCc. CGAATATAd. TGCCTCTC
Protein-coding sequences are the only highly conserved regions in our genomeTrueFalse
A mutational event inserts an extra nucleotide pair intoDNA. Which of the following outcomes do you expect?(1) No protein at all; (2) a protein in which one aminoacid is changed; (3) a protein in which three amino acidsare changed; (4) a protein in which two amino acids arechanged; (5) a protein in which most amino acids afterthe site of the insertion are changed.
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
A segment of DNA has the following sequence:TTGGATGCTGAACCTACGACA. What would the sequence be immediately after reaction withnitrous acid? Let the letters H represent hypoxanthine and Urepresent uracil.B. Let’s suppose this DNA was reacted with nitrous acid. Thenitrous acid was then removed, and the DNA was replicated fortwo generations. What would be the sequences of the DNAproducts after the DNA had replicated two times? (Note:Hypoxanthinepairs with cytosine.) Your answer should containthe sequences of four double helices.
For DNA ORF ATG.CTG.GTA.CTN.GTA.AAA, where N stand for any nucliotide (A, T, G, C) claculate the probablity of occurance of any nucliotide at position N.
6. How do you know if the halibut you purchased at thesupermarket is really halibut? To identify the sourceof a biological sample, scientists PCR amplify andthen sequence a region of DNA known to vary between species. For animals, this DNA region is a648–base pair portion of the mitochondrial cytochrome oxidase I gene. The sequence of this mtDNAregion acts as a so-called DNA barcode because adatabase exists that contains the sequences of thismtDNA region that are unique for hundreds ofthousands of animal species.a. Why do you think that a region of mitochondrialDNA is used for barcoding animals, as opposed toa region of nuclear genomic DNA?b. A single pair of PCR primers can be used tobarcode any species of fish. Explain how this ispossible.c. List criteria that scientists would have consideredwhen determining which mitochondrial DNAsequence to use for barcoding animals.
DNA is isolated from concentrated ocean water. One genome is studied, and the proportion of each nucleotide is A = 15%, C = 35%, G = 35% and T = 15%. Is this genome from a dsDNA or ssDNA organism? Explain your reasoning. Is this organism AT-rich or GC-rich?
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
You discovered that a species of bacteria can break down StyrofoamTM (polystyrene) products due to anenzyme it produces, polystyrenase. You wish to study the gene that codes for this enzyme.Task 1: DNA ExtractionTo begin work on the bacterium, you begin by extracting its genomic DNA (gDNA). What is the purpose ofthe following procedures? Answer briefly but completely.a. Using sodium dodecyl sulfate, a detergentAnswer: __________________________________ b. Adding RNase A and Proteinase K during extractionAnswer: __________________________________ c. Adding ethanol before recovering the DNA extractAnswer: __________________________________ Task 2: Polymerase Chain ReactionAfter purifying the gDNA extract, you want to isolate and amplify the polystyrenase gene. You perform PCRusing the appropriate gene-targeted primers. What is the purpose of the following PCR components? Answerbriefly but completely.a. DNA polymerase isolated from Thermus aquaticusAnswer:…
Examine the amino acid sequences from three organisms (A,B and C)Which organisms are the most closely related? Organism A: Val-Ser-Thr-Val Organism B: Leu-Leu-Ala Organism CVal SerAsp-Met
In human DNA, 80% of in sequences are methylated.A. adenines, ApTB. thymines, ApTC. cytosines, CpGD. guanines, CpGE. adenines, ApG