O W11 W11 W12 = W22 O W11 W12> W22 O W12> W11 = W22 O W11 = W22> W12

Q: Which of the following is the observed result of human exposure to a toxin? I. Increased…

A: Humans are often exposed to various industrial chemicals simultaneously via multiple exposure route.…

Q: How can a B cell have both IgM and IgD on its surface?

A: * B cells produce from lymphoid progenitor cell which develop in fetal liver and later in bone…

Q: lease explain the reason   To make a new DNA strand, you need (check ALL that apply)...     a…

A: DNA Deoxyribonucleic acid is the genetic material present in almost all living organisms. The DNA…

Q: Explain translocation, deletions and duplications

A: Chromosome is organized structure of DNA and proteins present in the nucleus of eukaryotic cell.Each…

Q: Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M…

A: The purpose of using mannitol at this concentration in isolation buffer  and assay buffer to…

Q: Multiple Choice Question: Which of the following sensory structures of insects can detect air- or…

A: Insects are among the most significant animals on the planet. They participate significantly in…

Q: 11. How are metaphase 12. If cells in the process of dividing are subjected to colchicine, a drug…

A:

Q: How are food products altered for those who do not make adequate amounts of this enzyme

A: Enzymes are proteins that can speed up a reaction without being eaten because they are catalytic or…

Q: You are working on a summer internship with a famous marine scientist. Your job is to use your…

A: Coelome Coelome is the body cavity present between two germ layes.

Q: Within a school of fish, each distance from its neighbors as they swim. When viewed from farther…

A: School of fish In biology, when a group of fish stays together and is swimming in a similar…

Q: In detail explain how photosystems I and II capture light using different photosystems

A: Photosystems, which are large complexes of proteins and pigments (light-absorbing molecules) that…

Q: 1. Incontinentia pigmenti is an X-linked dominant disorder characterized by skin abnormalities that…

A: Incontinentia pigmenti (IP): Incontinentia pigmenti (IP) is a genetic disorder that is inherited in…

Q: Using the Kirby-Bauer method, how could you determine if a bacterial pathogen was beginning to…

A: Kirby Baeur diffision method is a test to determine the sensitivity or resistance  of various…

Q: What are the abnormality and sex of this embryo? Will this embryo produce a healthy livebirth and…

A: The massively parallel sequencing technology known as "next-generation sequencing" (NGS) provides…

Q: Question 18 Replication origins have Repetitive lines; histone G-C rich; Helicase A-T rich; histone…

A: Introduction :- Histones are proteins that attach to DNA, form chromosomes, and regulate gene…

Q: 1. In rabbits, coat color is affected by a series of alleles with a hierarchy of dominance such that…

A: A succession of alkenes with a dominance hierarchy impacts coat color, such that c+>cch>ch>…

Q: You are studying how a newly discovered virus in bats enters their cells.  When you examine cells…

A: Virus is a microscopic organism it is not though made up of  a complex structure as it has only…

Q: What is true of cell signaling? Extracellular signals transduced by receptors always alter cell…

A: The cells receive signals from their external environment, which alters the cell's activity and…

Q: Homozygous wild-type male mice (AA BB CC) were crossed with triple mutant female mice (aa bb cc),…

A: If the geness are located on the same chromosome then they are called as linked genes. In this case…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: neurobiology How does asymmetric cell division and localization of sequential acting transcription…

A: Development biology studies how cells develop into organs and how time and geography impact cell…

Q: Problem 2: The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the…

A: * If the trait is dominant, then one of the parents will have the trait. Dominant traits usually not…

Q: DNA structure and its 3 chemical components

A: DNA is the genetic material in living organisms that contain genes which determine the…

Q: 3. Despite your chaotic nature, you various types of RNA species (molecules) following their…

A: rRNA is a ribonuclic achid which is synthesized inside the nucleus of the cell.

Q: Discuss the human life cycle and the purpose of meiosis. (please keep it short) 4 - 5 senttence

A: Life cycle of human: Human beings are made up of a billions of cells. Such large number of cells…

Q: Think about the average yield of ATP in eukaryotic cells. Is it stable or variable? The yield is…

A: ATP stands for adenosine triphosphate. It is an energy molecule that is produced mainly from…

Q: A client fell 2 days ago; he has a compound fracture of his left tibia. The physician performed an…

A: A damaged bone can be stabilised and healed using a procedure called open reduction and internal…

Q: Please describe two mistakes from the downloaded diagram on fertilization

A: Fertilization It refers to the process of fusion of male and female gametes to give rise to a new…

Q: Which of these organelles is directly involved in the synthesis, editing, or modification of cell…

A: The science of cell structure and function is known as cell biology, and it is based on the idea…

Q: Should aggression in humans be treated using medication? Explain why or why not

A: Aggressive behaviors can be managed well using non-pharmacological interventions. Medications should…

Q: Briefly explain how multi factorial variables in the environment act concurrently

A: A set of observations, each described by several different sets of variables, is subjected to…

Q: Matter is continually recycled between abiotic and biotic components of Earth's ecosystem in…

A: The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple usable…

Q: Name ten examples of bacteria and give their colony morphology. ( indicate the media used for each)

A: Scientists utilize a technique called colony morphology to define the properties of a specific…

Q: What is the Effect of colchicine

A:

Q: Outline the specific differences in the pelvis and the femur that are associated with bipedalism in…

A: Introduction :- When an organism uses its two back limbs or legs to travel on land, this is known as…

Q: The melting temperature Tm of DNA can be predicted by calculation without actually measuring it.…

A: It is the temperature at which half of the DNA has been converted to single-stranded DNA. The…

Q: Experiment # Growth Condition plus 0₂ minus 0₂ plus O2, plus cyanide* 1 2 3 cyanide stops the…

A: Cellular respiration is a multistep metabolic pathway involving the metabolism of glucose in the…

Q: the bone structure inside the wing of a bird is a clear example of the statement form fix finction.…

A: Density is a one thing that helps with the flying in birds. Hollow bones don't make birds body…

Q: Describe the pharmaceutical uses of at least four (4) different types of alkaloidal drugs, including…

A: Introduction; A group of naturally occurring organic nitrogen-containing substances known as…

Q: Which of the following is NOT true regarding bones? -Cancellous: compact (shaft) -Cortical: Compact…

A: Collagen, a protein that forms the skeleton of bones, is combined with calcium phosphate, a mineral…

Q: 1. Give two SPECIFIC examples of when, where, and why temperature and pH are important to the…

A: Enzymes are biological catalysts that speed up the rate of chemical reactions. Enzymes are highly…

Q: Discuss the Medico-legal case report and custody of the MLC records

A: Medico-legal case reports are made by medical professionals who is taken as a expert witness in a…

Q: Using figure (a) above as guide, list the five components in the CRISPR-Cas9 bacterial defense…

A: CRISPR is a acronym for Clustered regularly interspaced short palindromic repeats. It forms a very…

Q: Of what value is Gram staining?

A: Gram staining is a method frequently used to distinguish between two sizable groups of bacteria…

Q: Compare the appearance of the "e" when viewed with the naked eye to its appearance when viewed under…

A: Introduction: - Microscopes are optical devices used to magnify an object. They are commonly used in…

Q: Making food system nutrition sensitive contribute to addressing all forms of malnutrition. Discuss…

A: When it comes to malnutrition, there are a number of types that can affect people of all ages. The…

Q: independent of water for reproduction limited to short heights transport of water by diffusion…

A: Mosses : They require a moist environment for reproduction. Their flagellated sperms swim through…

Q: You have been put in charge of managing a population of the endangered pink fairy armadillo. The…

A: We know that  Nt = No*2ñ  Nt is population after time t  No is initial population  n is time taken…

Q: What is B cell selection?

A: B Cell Selection: B Cells are the immunogenic cells, which are a type of lymphocytes or white blood…

Q: Is orthophosphate a competitive inhibitor of alkaline phosphatase and why?

A: In competitive inhibition, an inhibitor that resembles the normal substrate binds to the enzyme,…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.